PLoS Neglected Tropical Diseases

Home Transcriptional and immunological analysis of the putative outer membrane protein and vaccine candidate TprL of Treponema pallidum
Transcriptional and immunological analysis of the putative outer membrane protein and vaccine candidate TprL of <i>Treponema pallidum</i>
Transcriptional and immunological analysis of the putative outer membrane protein and vaccine candidate TprL of Treponema pallidum

The authors have declared that no competing interests exist.

Article Type: Research Article Article History
  • Altmetric
Abstract

Background

An effective syphilis vaccine should elicit antibodies to Treponema pallidum subsp. pallidum (T. p. pallidum) surface antigens to induce pathogen clearance through opsonophagocytosis. Although the combination of bioinformatics, structural, and functional analyses of T. p. pallidum genes to identify putative outer membrane proteins (OMPs) resulted in a list of potential vaccine candidates, still very little is known about whether and how transcription of these genes is regulated during infection. This knowledge gap is a limitation to vaccine design, as immunity generated to an antigen that can be down-regulated or even silenced at the transcriptional level without affecting virulence would not induce clearance of the pathogen, hence allowing disease progression.

Principal findings

We report here that tp1031, the T. p. pallidum gene encoding the putative OMP and vaccine candidate TprL is differentially expressed in several T. p. pallidum strains, suggesting transcriptional regulation. Experimental identification of the tprL transcriptional start site revealed that a homopolymeric G sequence of varying length resides within the tprL promoter and that its length affects promoter activity compatible with phase variation. Conversely, in the closely related pathogen T. p. subsp. pertenue, the agent of yaws, where a naturally-occurring deletion has eliminated the tprL promoter region, elements necessary for protein synthesis, and part of the gene ORF, tprL transcription level are negligible compared to T. p. pallidum strains. Accordingly, the humoral response to TprL is absent in yaws-infected laboratory animals and patients compared to syphilis-infected subjects.

Conclusion

The ability of T. p. pallidum to stochastically vary tprL expression should be considered in any vaccine development effort that includes this antigen. The role of phase variation in contributing to T. p. pallidum antigenic diversity should be further studied.

Syphilis is still an endemic disease in many low- and middle-income countries and has been resurgent in high-income nations for almost two decades now. In endemic areas, syphilis still causes significant morbidity and mortality in patients, particularly when its causative agent, the bacterium Treponema pallidum subsp. pallidum is transmitted to the fetus during pregnancy. Although there are significant ongoing efforts to identify an effective syphilis vaccine to bring into clinical trials within the decade in the U.S., such efforts are partially hindered by the lack of knowledge on transcriptional regulation of many genes encoding vaccine candidates. Here, we start addressing this knowledge gap for the putative outer membrane protein (OMP) and vaccine candidates TprL, encoded by the tp1031 gene. As we previously reported for other putative OMP-encoding genes of the syphilis agent, tprL transcription level appears to be affected by the length of a homopolymeric sequence of guanosines (Gs) located within the gene promoter. This is a mechanism known as phase variation and often involved in altering the surface antigenic profile of a bacterial pathogen to facilitate immune evasion and/or adaptation to the host milieu.

Haynes,Fernandez,Romeis,Mitjà,Konda,Vargas,Eguiluz,Caceres,Klausner,Giacani,and Hawley: Transcriptional and immunological analysis of the putative outer membrane protein and vaccine candidate TprL of Treponema pallidum

Introduction

Syphilis is a chronic sexually transmitted infection that despite being relatively easy to prevent, diagnose, and treat, still represents a burden for public health as it causes significant morbidity and mortality worldwide. The World Health Organization estimates that syphilis global prevalence and incidence range between 18 to 36 million cases and between 5.6 to 11 million new cases every year, respectively [1,2]. Although the majority of those cases occur in low- and middle-income countries where the disease is endemic, syphilis rates have also been steadily increasing for two decades in high-income countries, where men who have sex with men (MSM) and HIV-infected populations are affected [38]. In the US, for example, the rate of early syphilis in 2018 was 10.8 cases per 100,000 population, which represents a 414% increase compared to the 2.1 cases per 100,000 population reported in 2000 [3]. In absence of treatment, syphilis might progress to affect patients`cardiovascular and central nervous systems, potentially leading to aortic aneurism, stroke, hearing or visual loss, dementia, and paralysis [9]. Furthermore, mother-to-child transmission of the infection during pregnancy accounts for up to 50% of stillbirths in sub-Saharan Africa and a high proportion of perinatal morbidity and mortality cases [10]. Additionally, in the US, the recent syphilis rate increase in women of reproductive age led to an increase in congenital syphilis cases from 362 cases in 2013 to 1,306 in 2018 [3]. Lastly, evidence that syphilis causes an approximate 5-fold increase in the likelihood of HIV transmission and acquisition [11] further highlights the threat posed by this disease to global health.

Overall, syphilis epidemiology supports the necessity for an effective vaccine to help disease control. Ongoing vaccine development efforts aim to elicit opsonic antibodies that target conserved surface epitopes of putative outer membrane proteins (OMPs) of the syphilis agent, the spirochete bacterium Treponema pallidum subsp. pallidum (T. p. pallidum), and confer sterilizing immunity by promoting opsonophagocytosis of T. p. pallidum by IFNγ-activated macrophages [12,13]. That strategy, however, finds an obstacle in our limited knowledge of how this spirochete controls transcription of genes encoding vaccine candidates. Such knowledge is however pivotal to devising an effective vaccine, as antibodies generated against an antigen whose expression can be downregulated or even abrogated without affecting pathogen virulence or viability would be ineffective in clearing organisms not expressing the target. The only published high-throughput study that investigated the T. p. pallidum transcriptome used microarrays to provide a snapshot of the level of expression of OMP-encoding T. p. pallidum genes in treponemes harvested at peak orchitis from a rabbit infected with the Nichols strain, but could not address the topic of gene regulation [14]. Our past studies, on the other end, although limited to a subset of OMP-encoding genes, have suggested that transcription of several of those genes can be affected by a homopolymeric tract of guanosines (poly-G) of varying length located within the gene promoter [15,16]. Only a poly-G length of eight or fewer nucleotides, for example, was permissive for transcription of the genes encoding the T. pallidum repeat (Tpr) E, G, and J putative porins [16], while the poly-G associated with tp0126 gene (encoding an OmpW homolog) and located between the -35 and -10 consensus sequences of the tp0126 promoter, allowed optimal gene transcription when its length brought the overall distance between the -35 and -10 sites to 17 nucleotides, which is known to be optimal for RNA polymerase binding [15].

Transcriptional changes induced by stochastic expansion and contraction in length of repetitive sequences, such as homomonomeric or homodimeric repeats are collectively known as phase variation, a mechanism used by pathogenic bacteria to rapidly create phenotypic diversity within a population. When this process influences the expression of surface antigens, like in the case of Tp0126 or the Tpr proteins [15,16], it could facilitate immune evasion or perhaps foster adaptation to diverse host microenvironments. An example is the variable expression of opacity (Opa) proteins in Neisseria meningitidis, reported to change the pathogen's tropism for human epithelium, endothelium, and phagocytic cells [17]. In T. p. pallidum, the presence of a poly-G upstream of an annotated ORF could, therefore, be an indicator that the gene undergoes phase variation, particularly if the poly-G localizes within the experimentally determined or predicted gene promoter. Additionally, like in the case of the Tp0126 ORF, the experimental assessment of the poly-G position in relation to the gene transcriptional start site (TSS) allowed us to redefine the length of the ORF and identify a putative NH2-terminal cleavable signal peptide previously embedded within the larger reading frame originally but mistakenly annotated. Such finding supported Tp0126 as a novel OMP, and allowed its identification as an OmpW homolog of the syphilis spirochete. A poly-G is also reported upstream of the tp1031 gene, encoding the Tpr protein, TprL, which is conserved among syphilis strains and subspecies and hence a possible vaccine candidate.

In the current study, we investigated the role of the tprL-associated poly-G in transcription of this gene after redefining the boundaries of this ORF. Additionally, we compared tprL transcription in T. p. pallidum to an isolate of T. p. pertenue (the Gauthier strain), the spirochete agent of the endemic treponematosis yaws [18]. Although nearly identical to the syphilis spirochete at the genomic level, T. p. pertenue strains carry a 378-bp deletion that eliminates the poly-G upstream of the tprL gene as well as the annotated gene start codon (SC), providing a naturally-occurring mutant for our studies, given that the agents of human treponematoses cannot be genetically altered. Finally, we compared the humoral response to TprL in rabbits and patients infected with the agents of syphilis and yaws to gain insight into whether TprL is produced by the yaws agent.

Materials and methods

Ethics statement

Only male New Zealand White (NZW) rabbits ranging from 3.5–4.5 Kg were used in our studies. Specific pathogen-free (SPF; Pasteurella multocida, and Treponema paraluiscuniculi) animals were purchased from Western Oregon Rabbit Company (Philomath, OR) and housed at the University of Washington (UW) Animal Research and Care Facility (ARCF). Care was provided in accordance with the procedures described in the Guide for the Care and Use of Laboratory Animals [19] under protocols approved by the UW Institutional Animal Care and Use Committee (IACUC; Protocol # 4243–01, PI: Lorenzo Giacani). However, because only random animals were tested for T. paraluiscuniculi infection by the vendor, all rabbits were bled and tested with a treponemal (Fluorescent Treponemal Antibody Absorbed, FTA-ABS, Trinity Biotech, Bray, Ireland) and a non-treponemal test (Venereal Disease Research Laboratory, VDRL, Becton Dickinson, Franklin Lakes, NJ) upon arrival at the ARCF and prior to use. Both tests were performed according to the manufacturer instructions, with the exception that a secondary FITC-labelled goat anti-rabbit IgG was used instead of the anti-human secondary for the FTA-ABS test. Only seronegative rabbits were used.

Human serum specimens from yaws- and syphilis-infected patients were obtained as de-identified samples and did not require IRB approval. More specifically, twenty-five sera from serologically confirmed (Rapid Plasma Reagin, RPR; Treponema pallidum Particle Agglutination, TPPA; and/or Enzyme Immune Assay, EIA) syphilis-infected patients were collected by the King County Public Health (KCPH) laboratory at Harborview Medical Center in 2020. All but one sample were tested by RPR and yielded titers ranging between 1:4 and 1:512. Sera from serologically confirmed (RPR, TPPA and/or EIA) yaws-infected patients (n = 25) were collected by Dr. Oriol Mitjá while leading the WHO-sponsored yaws elimination campaign in Lihir Island, Papua New Guinea [20].

Experimental infections and nucleic acid extraction

Three T. p. pallidum strains (Nichols, Chicago, and Seattle 81–4), and one T. p. pertenue (Gauthier) strain were propagated by means of intratesticular infection as previously reported [21]. Rabbits were infected with 2 x 107 T. pallidum per testis for Nichols and Chicago, and 5 x 106 organisms per testis for Seattle 81–4, and Gauthier. Treponemes were harvested at peak orchitis (approximately day 10 post-infection for the Nichols and Chicago strains; day 20 for Seattle 81–4, and Gauthier) to recover organisms prior to immune clearance. Briefly, testes were minced in 10 ml of saline and shaken for 5 min. Suspensions were spun for 10 min at 1,000 rpm in a 5430 Eppendorf centrifuge (Eppendorf, Hauppauge, NY) to remove host cellular debris. For RNA and DNA isolation, 1-ml aliquots were spun for 30 min at 12,000 rpm at 4°C and the pellets resuspended in 400 μl of Trizol buffer (Thermo Fisher Scientific, Waltham, MA) or 400 μl of DNA lysis buffer (5 mM Tris, pH 8.0; 50 mM EDTA; 0.25% SDS), respectively. For the analysis of the length of the poly-G associated to the tprL (tp1031) ORF, DNA was isolated as previously described [22] using the QIAamp DNA Mini Kit (Qiagen Inc., Chatsworth, CA). RNA extraction was performed following Trizol manufacturer’s instructions. Prior to reverse transcription, total RNA samples were treated with DNase I (Thermo Fisher Scientific). DNA-free RNA was checked for residual DNA contamination by qualitative amplification using primers specific for the tp0574 gene encoding the 47 kDa lipoprotein (Table 1), conserved in all strains, as already described [23]. Reverse transcription (RT) of total RNA was performed using the Superscript III First Strand Synthesis Kit (Thermo Fisher Scientific) with random hexamers according to the provided protocol. cDNA samples were diluted 1:5 with molecular grade water and stored in single-use aliquots at -80°C until use.

Table 1
Primers used in this study.
Gene target and purposeForward and reverse primer sequences (5’-3’)Amplicon length (bp)
tp0574, qPCRCGTGTGGTATCAACTATGG

TCAACCGTGTACTCAGTGC
313
Tp1031 (tprL), qPCRATAAGAATGCGGCCGCGGTGGTTTCCCATTTGGAAGG ATAAGAATGCGGCCGCCAAGTAGTCTGTAAGCTGCCTG295
tprL, 5`-RACEGTCAGGTACGCGTTGTAGCA (first antisense primer) GGAGCGTTGCTTCAAAAGAC (second antisense primer)N/A
tprL, FFLANED-CACGGGGCGATACAAAACTC GTTTCTTCCCTCCCGACCCATTTCATT292
Tp1030 (assessment of RNA synthesis)ACGTTTCGTGCGCTCATAAT

CCCCTCCTCAGGTAGACAGG
164
Gene associated to poly-GForward1 and reverse primer sequences (5’-3’)Amplicon length (bp)Poly-G position2
tp0013NED-CGCGTCGTCCCTACATAAGT

CTGCACACACCATCTCTCCA
235-60
tp0026FAM-GTAGTGGAGGGTGTGCTCTT

GTTTCTTTTTCCGCAGCAGAGAACAAC
215-100
tp0041-423NED-GGTAACGTGGAAGTGCTCAC

GTTTCTTCAGAGACAGCATGCGGTTC
190-31
tp0107FAM-TCTAGGAGAGCGAAGGATGC

CGTGTAGAAGGCGATTGGTG
242-307
tp0145HEX-ACTTTTACCGCAGCGTGTTT

TACCCCTCAAGCACTCTCAC
250+1191
tp0179NED-TGTCTGCACTGTCTTCCACA

ATCTTCCTCTGTGCCGTGAA
238-80
tp0216FAM-GGCTCGATGTGAAGCGTATT

ACGTGCATCAAAGTCATCGC
202+60
tp0257FAM-AAGGTAGGATCAGCGCTCAG

GTTTCTTACTTTCGAGGCAAAGGTGTG
228+29
tp0279NED-TCCGTTTTCTGCCCTGTACT

GTTTCTTTCAAGAGCGATGATCACGGT
162+7
tp0347FAM-GTTGGTCCCAGTGGTTGTTC

GTTTCTTACGACAATGCCCAGAAACAC
169+99
tp0379HEX- AGCAGGGTTACACGTACGAA

GTTTCTTAGCCAAAGATGAGCCTGAGT
193-70
tp0381HEX-CCAGCTCACATACATCCCCT

GTTTCTTAAAAGACCCGTATCCGCCA
176-7
tp0479HEX-TGGCATACTCCTCTTCGCAA

CAGCGAGCAAAGAACCTACG
180+95
tp0617HEX-TGATGTTCCGTGGTCAGTGT

GTTTCTTAACGTACCACCCTCCATGTT
184-1
tp0798NED-TGACTGAAGGTTGGCTACGT

GATCAAGCCACCAAGACTGC
234+826
tp0969FAM-CAGTGGTAGGGACGTTCAGA

CCGCGTACACCAAGACTTTC
246+56
tp0986HEX-TGTACACGTCTAGGGGCATC

ACCAGGTTACGCGTAAATGC
202-7

1 Forward primer is labelled with either NED HEX or FAM

2 Location indicates the position of the first poly-G residue in relation to the gene annotated start codon. A negative value indicates that the poly-G tract is located upstream of the gene ATG. A positive value indicates that the poly-G tract is within the gene ORF.

3 TP0041 is a predicted ORF of 120 nt and may represent a pseudogene or an intergenic region.

Intradermal (ID) experimental infections to assess development of humoral immunity to recombinant TprL (TprL) over time were performed on a total of four rabbits. Two rabbits were infected with the Nichols strain in six sites on their shaved backs, and two with the Gautier strain immediately after harvesting from a routine intratesticular strain passage. Each site received 106 spirochetes. Blood was collected from these rabbits at regular intervals for ~90 days. Extracted serum was heat-inactivated at 56°C for 30 min and stored at -20°C until use.

A clonal Nichols strain of T. pallidum (Nichols Houston O) was obtained as previously described [24,25]. This technique, originally developed to study antigenic variation of the TprK protein, was previously shown to be effective to obtain isogenic treponemal isolates [24,2628]. Briefly, to obtain the Nichols Houston O strain, a naïve rabbit was injected intravenously (IV) with 108 T. pallidum (Nichols Houston strain) cells through the marginal ear vein, and treponemes were allowed to disseminate and form isolated skin lesions visible on the rabbit shaven back. Clonality is achieved because each discrete skin lesion is believed to be seeded by a single treponemal cell that carries a unique tprK sequence [24,26,29]. Biopsy specimens of isolated skin lesions were minced in 1 ml of normal rabbit serum (NRS). Following homogenization, approximately half of the treponemal suspension obtained was injected into a naïve recipient rabbit to propagate the clone. After multiplication of the clonal isolate within the rabbit, treponemes were harvested again and used to infect three naïve rabbits intradermally (ID, 106 T. pallidum cells per site) in multiple sites in their shaven backs. Clonality of the treponemal inoculum was assessed by sequencing as previously reported [29] and by fluorescent fragment length analysis (FFLA, see paragraph below) of the tprL-associated poly G tract. Biopsies from lesions appearing at the intradermal injection sites were collected from all infected rabbits weekly for three weeks and minced in 1X lysis buffer for DNA extraction (as described above) to evaluate variation of poly-G tract upstream of tprL using FFLA.

Quantification of tprL message by RT-qPCR

A relative quantification protocol using external standards was used to analyze the tprL message level at the time of bacterial harvest from rabbit testes. This approach normalizes the amount of message from the tprL gene to that of the tp0574 gene, used as housekeeping gene. To obtain the standards, sequences of the tprL and tp0574 genes were amplified from Nichols DNA using primers conserved across all strains and cloned into a pCRII-TOPO vector (Thermo Fisher Scientific). Primers for both targets are shown in Table 1. The tp0574 amplicon was directly cloned into the vector TA site, while the tprL amplicon was cloned using the NotI restriction site (underlined in primer sequences). Resulting construct was linearized by EcoRV digestion, and standard curves were generated by serially diluting the plasmid (tenfold) over the 106−100 copies/μl concentration range. The threshold value for the maximum acceptable error associated with a standard curve was set to 0.05. Amplification reactions and data collection were carried out on a Roche LightCycler (Basel, Switzerland). All reactions were performed following the manufacturer’s instructions with the Roche FastStart Universal SYBR Green Master Kit (Roche). The same primers reported above for tp0574 and tprL (but without restriction tags in the latter case) were used for the qPCR. Amplifications were performed with three microliters of the final cDNA preparation in quadruplicate. Amplification conditions for tp0574 were: annealing at 60°C for 8 sec following hot start, and extension for 13 s at 72°C. Amplicon melting temperature was 88°C. Amplification conditions for tprL were: annealing at 62°C for 6 s following hot start, and extension for 12 s at 72°C. Amplicon melting temperature was 90°C. Differences between levels of tprL expression within strains were compared using Students t-test, with significance set at p<0.05.

Identification of the tprL transcriptional start site

Rapid Amplification of cDNA Ends (5’-RACE, Thermo Fisher Scientific) was used to determine the tprL gene transcriptional start site (TSS) and infer the location of the tprL promoter. 5’-RACE was performed on total RNA from T. p. pallidum Nichols Seattle and T. p. pertenue Gauthier strains following the kit manufacturer’s instructions. For each strain the procedure was carried on in duplicate using the same template RNA. Briefly, for the initial reverse transcription step, 1 μg of sample RNA and 2.5 pmoles of a first tprL-specific antisense primer (Table 1) were used for reverse transcription, which was followed by dC-tailing of the cDNA. The subsequent amplifications were performed using five microliters of dC-tailed cDNA in 50 μl final volume containing 2.5 units of GoTaq polymerase (Promega), 200 μM of each dNTP, 1.5 mM of MgCl2, and 400 nM of a second tprL-specific antisense primer (Table 1) annealing upstream of the one used for first-strand synthesis and the provided Abridged Anchor Primer. Cycling parameters were initial denaturation (94°C) and final extension (72°C) for 10 min each. Denaturation (94°C), annealing (60°C) and extension (72°C) steps were carried on for 1 min each for a total of 45 cycles. PCR products were purified QIAquick PCR Purification Kit (Qiagen) and cloned into the pCRII-TOPO-TA vector (Thermo Fisher Scientific) according to instructions. For each cloning reaction, plasmid DNA from at least ten colonies was extracted using the Plasmid Mini Kit (Qiagen) and sequenced with vector-specific sense and antisense primers. Sequence data were analyzed using Bioedit, available at https://bioedit.software.informer.com/.

Analysis of the tprL-associated poly-G length

A DNA fragment of 292 bp containing the tprL-associated poly-G repeat was amplified for fluorescent fragment length analysis (FFLA), a method already used to evaluate the variability of poly-G tracts upstream of T. p. pallidum genes among and within isolates [15]. Briefly, amplification was performed using a 6-NED-labeled sense primer and an unlabeled antisense primer (Table 1). Amplifications were performed in 50 μl final volume using 2 U of AccuPrime Pfx Polymerase (Thermo Fisher Scientific) and 100 ng of DNA template in each reaction. Mix was also supplied with primers, MgSO4, and dNTPs at final concentrations of 300 nM each, 1 mM, and 300 μM, respectively. Amplifications were carried on for 45 cycles, with denaturation (94°C), annealing (60°C) and extension (68°C) times of 30 sec, 30 sec, and 1 min, respectively. Initial denaturation (94°C) and final extension (68°C) steps were of 10 min each. For each strain, two independent amplifications were performed using the same template DNA. Amplification products were purified using the QIAquick PCR Purification Kit (Qiagen). Concentrations were measured spectrophotometrically and all samples diluted to 0.2 ng/μl final concentration. One microliter of each sample was mixed with 15.4 μl of highly deionized formamide and 0.1 μl of HD400 ROX-labeled DNA size marker (both reagents from Thermo Fisher Scientific).

Samples were transferred to a 96-well plate and denatured by incubation at 94°C for 2 min, and loaded onto an ABI3730xl DNA analyzer (Thermo Fisher Scientific) to be separated by capillary electrophoresis. Electropherograms were analyzed using the GeneMapper 4.0. Data on amplicon length (determined by comparison to the ROX-labeled marker) and intensity (measured as area under a peak) were collected to evaluate the proportion of amplicons with poly-G’s of different length within each sample. For each amplification, FFLA was performed in triplicate. For data analysis, the sum of the area underneath all peaks generated by amplicons with the same number of G’s was divided by the total area underneath all peaks.

GFP reporter assay

The tprL promoter was amplified using the sense and antisense primers 5’-ccccctgtctacctgagga and 5’- gcatggtgcagttccttccc, respectively and cloned into the pGlow-TOPO TA vector (Thermo Fisher Scientific), carrying a promoter-less GFP reporter gene. Primers were designed to include the putative TprL start codon as the first codon of the GFP ORF. Amplification was performed in 50 μl final volume using 2 U of GoTaq Polymerase (Promega) and 100 ng of DNA template in each reaction, and carried out for 45 cycles, with denaturation (94°C), annealing (60°C) and extension (68°C) times of 30 sec. Initial denaturation (94°C) and final extension (68°C) steps were of 10 min each. Amplification products were cloned directly into the pGlow-TOPO vector according to the manufacturer’s instructions. Amplicon included 90 nt upstream of the poly-G tract to include the tprL promoter, and a putative ribosomal binding site (RBS, GGAG) located 4 nucleotides upstream of the TprL predicted start codon. With the exception of the start codon, no other TprL codons were present in the constructs. Expression of GFP from these constructs resulted in the addition of nine extra amino acids to the actual GFP peptide, encoded by the TprL start codon and eight additional vector-encoded. In total, two different constructs were obtained for the tprL promoter, with poly-G repeats 8 and 10 nt long. A construct containing the lac promoter upstream of the GFP gene was used as a positive control. As a negative control, to determine background fluorescence, the tp0547 ORF fragment (the same used for message quantification purposes, see above) and not predicted to harbor a promoter or a ribosomal binding site was inserted upstream of the GFP coding sequence of the pGlow-TOPO vector. All constructs were sequenced on both strands to verify sequence accuracy and correct insert orientation using sanger sequencing. Constructs were then used to transform TOP-10PE E. coli cells (Thermo Fisher Scientific) which do not carry the lacI repressor gene. For GFP fluorescence measurements, cells transformed with the various constructs were inoculated from a plate into 4 ml of LB-ampicillin (100 μg/ml) broth and grown at 37°C for 4 hr. Optical density (OD600) of all cultures was then measured using a biophotometer (Eppendorf) and cultures were diluted to identical optical density (0.5 Absorbance Units, AU). Subsequently, OD600 and fluorescence were recorded in parallel until cultures reached an OD600 of ~2 AU. For fluorescence readings, 400 μl of culture were centrifuged for 4 min at full speed on a tabletop centrifuge and resuspended in an equal volume of phosphate buffered saline (PBS). Cells were then divided in three wells (100 μl/well) of a black OptiPlate-96F (Perkin Elmer, Boston, MA) for top fluorescence reading. Excitation and emission wavelength were 405 and 505 nm, respectively, and readings were performed in a BioTek Synergy Microplate Reader (BioTek, Winooski, VT). Reported data represent fluorescence (expressed in Arbitrary Units, A.U.) normalized to the optical density of the culture. Background fluorescence values were obtained using E. coli cells transformed with the reporter vector containing the promoterless tp0574 ORF fragment. Differences in levels of fluorescence between cultures were compared using Student’s t-test, with significance set at p<0.05.

Expression of recombinant TprL

A tprL gene, devoid of signal peptide and codon-optimized for expression in E. coli was synthesized by GenScript. The gene was then subcloned into the pET28a(+) vector, between the BamHI and XhoI sites. Recombinant TprL spanned 489 amino acids. The tp0574 gene was amplified using the primers sense 5’-tgtggctcgtctcatcatga and antisense 5’- ctgggccactaccttcgcac. Amplification was performed in 50 μl final volume using 2 U of GoTaq Polymerase (Promega) and 100 ng of Nichols DNA template. Mix was also supplied with primers, MgSO4, and dNTPs at final concentrations of 300 nM each, 1.5 mM, and 300 μM, respectively. Amplifications were carried on for 45 cycles, with denaturation (94°C), annealing (60°C) and extension (68°C) times of 30 sec, 30 sec, and 1 min, respectively. Initial denaturation (94°C) and final extension (68°C) steps were 10 min each. Amplicon was cloned directly the pEXP-5-NT/TOPO vector (Thermo Fisher Scientific). Constructs were sequenced prior to expression to ensure lack of amplification errors in the transgene as well as correct orientation into the vector. For protein expression, transformed E. coli Rosetta2 DE3 pLysS BL21 derivative cells (Sigma-Aldrich, ST. Louis, MO) were grown at room temperature in auto-inducing media according to Studier et al. [30] and harvested after 3 days of incubation. More specifically, auto-inducing media was made by adding to ZYM base media 1 mM (final concentration) MgSO4, 1x trace metal mix (final concentrations: 50 μM Fe, 20 μM Ca, 10 μM MnCl2 and ZnSO4, 2 μM each of CoCl2, CuCl2, NiCl2, Na2MoO4, Na2SeO3, and H3Bo3), 0.5% glucose, 1x NPS (0.025 M (NH4)2SO4, and 0.05 M of each Na2HPO4 and KH2PO4), and 1x 5052 (0.5% glycerol, 0.05% glucose, 0.2% α-lactose).

Purification was performed by nickel affinity chromatography under denaturing conditions using the Ni-NTA Agarose gravity chromatography System (Qiagen). Inclusion bodies containing insoluble recombinant proteins were isolated by successive rounds of sonication and centrifugation, then resuspended in 1X binding buffer (0.5 M NaCl, 20 mM Tris-HCl, 5 mM imidazole, pH 7.9) containing 6 M urea. After 1 h incubation in ice, suspensions were centrifuged, and supernatants passed through a 0.45 μm filter. Purification was followed by dialysis against PBS. Products were tested for size and purity by SDS-PAGE and quantified using a Bicinchoninic Acid Assay kit (Pierce, Rockford, IL).

ELISA with recombinant TprL and Tp0574 antigens

Purified recombinant TprL in PBS and recombinant Tp0574 (the 47 kDa lipoprotein, as a positive control antigen), were used to coat the wells of a 96-well flat bottom EIA/RIA microplates (Corning LifeSciences, Corning, NY). Plates, containing 15 picomoles/well of TprL or Tp0574 protein in 50 μl were incubated at 37°C for 2 h and subsequently at 4°C overnight to induce antigen binding to the test wells. Wells were then washed three times with PBS containing 0.05% Tween-20 (Sigma-Aldrich), blocked by incubation overnight at 4°C with 200 μl of 3% nonfat milk-PBS/well and washed again the next morning. In addition to the sera obtained from experimentally infected animals, sera available from previous experiments [15] from animals infected with additional strains of T. pallidum (MexicoA, Chicago, SS14, Bal3, and Sea81-4) and T. endemicum (IraqB) were also used here. Ten microliters of each serum (either from T.p. pallidum or T.p. pertenue infected animals or patients) were diluted 1:20 in 1% nonfat milk-PBS and 100 μl dispensed into wells. Sera were incubated over night at room temperature. Wells were then washed three times with PBS containing 0.05% Tween-20 (Sigma-Aldrich). One hundred microliters of secondary antibody (alkaline phosphatase-conjugated goat anti-rabbit IgG or goat anti-human IgG, both from Sigma-Aldrich) diluted 1:2,000 in 1% nonfat milk-PBS were then added to each well and the plates incubated for additional 3 h at room temperature before repeating the washing step. After addition of 50 μl of 1 mg/ml para-nitrophenyl phosphate (Sigma-Aldrich) to each well, plates were developed for 45 min, and read at 405 nm on a BioTek Microplate reader. The mean of background readings (from no antigen control wells) was subtracted from the mean of triplicate experimental wells for each serum.

Genome-wide analysis of the poly-G sequence variability in T. p. pallidum and assessment of tp1030 transcription

A previously performed analysis revealed several poly-G tracts (≥ 8 nt) [15] distributed throughout the T. p. pallidum Nichols strain genome [31] associated to as many genes. To investigate how many of those elements are variable in the T. p. pallidum strains used here, and hence possibly affecting gene expression at the transcriptional or translational level, we applied the same FFLA technique described above for the tprL poly-G to each of these homopolymeric tracts. Primers are reported in Table 1. Forward primers were labelled with different fluorophores (FAM, HEX, or NED) to multiplex three targets at the time. Amplification and separation by capillary electrophoresis were performed as described above for the tp1031 gene.

Amplification of the tp1030 gene was performed using cDNA obtained from strains (Nichols, Chicago, Sea81-4, and Gauthier) harvested at peak orchitis to quantify tprL expression. Amplification was performed in 50 μl final volume using 2 U of GoTaq Polymerase (Promega) in each reaction, and carried out for 45 cycles, with denaturation (94°C), annealing (60°C) and extension (72°C) times of 30 sec. Initial denaturation (94°C) and final extension (72°C) steps were of 10 min each. Results were visualized by gel electrophoresis.

In silico analysis of the extended TprL protein

In silico analysis on the extended TprL ORF to support it as a putative T. pallidum OMP was performed using a series of computational tools. Presence of a cleavable signal peptide was predicted by SignalP 4.1 (http://www.cbs.dtu.dk/ervices/SignalP/) [32], PrediSi (http://www.predisi.de/) [33], and LipoP (http://www.cbs.dtu.dk/services/LipoP/) [34]. For OM location, we used CELLO [35], PSORTb 3.0 [36], BOMP [37], HHPRED (https://toolkit.tuebingen.mpg.de/tools/hhpred) [38] and PRED-TMBB (http://bioinformatics.biol.uoa.gr/PRED-TMBB/) [39]. Sequence and structural homology of the TprL ORF to other bacterial proteins was investigated using Phyre2 (http://www.sbg.bio.ic.ac.uk/~phyre2/html/page.cgi?id=index) [40], I-TASSER (https://zhanglab.ccmb.med.umich.edu/I-TASSER/) [41] and LOMETS (https://zhanglab.ccmb.med.umich.edu/LOMETS/) [42] using default parameters.

Results

Analysis of tprL transcription levels during experimental infection

As previously described, our message quantification approach normalizes the tprL message level to that of the tp0574 gene [43]. Quantification data showed that tprL mRNA is variably expressed in T. pallidum strains and subspecies harvested at peak orchitis (Fig 1). Compared to T. p. subsp. pertenue (Gauthier strain), all T. p. subsp. pallidum strains (Nichols, Chicago, and Seattle 81–4) showed a significantly higher level of tprL mRNA (p<0.05; Fig 1). tprL mRNA levels detected in Nichols and Chicago were not significantly different, while the Seattle 81–4 strain showed the higher message level of this gene (Fig 1) among the syphilis isolates. This result supported the existence of mechanisms affecting tprL transcription.

tprL mRNA levels normalized to the tp0574 message in the T. p. pallidum Nichols, Chicago and Seattle 81–4 strains and in the in the T. p. pertenue Gauthier strain harvested at peak orchitis post-IT inoculation.
Fig 1

tprL mRNA levels normalized to the tp0574 message in the T. p. pallidum Nichols, Chicago and Seattle 81–4 strains and in the in the T. p. pertenue Gauthier strain harvested at peak orchitis post-IT inoculation.

Asterisk (*) indicates a significant difference (p<0.05) compared to the Gauthier strain.

Identification of the tprL transcriptional start site and analysis of variability of the tprL-associated poly-G

Upon performing 5`-RACE with T. p. pallidum RNA, the tprL TSS was identified to be the fourth nucleotide downstream of the poly-G (Fig 2A). This finding was similar to what was previously reported for other tpr genes that are paralogous to tprL that also carry a poly-G of varying length upstream of their TSS [16]. We then re-assessed the TprL protein annotation. Analysis of the sequence downstream of the newly identified TSS allowed us to predict a putative ribosomal binding site (RBS) and an alternative start codon (SC) for TprL (Fig 2A). This prediction extended the previously annotated TprL ORF by 88 codons. More importantly, this additional sequence was predicted to contain a cleavable signal peptide (aa 1–25, underlined in Fig 2A) by PrediSi, LipoP, and SignalP, which is necessary for OMP sorting to the bacterial surface [44,45].

(A). Cartoon depicting the tprL ORF as originally annotated in the T. pallidum Nichols strain [31] (blue) showing the location of the homopolymeric G tract (poly-G), the experimentally determined TSS. Asterisks indicate the newly predicted (*) TprL ribosomal binding site (RBS) and start codon (SC) based on the TSS identification. According to this model, the TprL ORF encompasses 88 additional amino acid residues located upstream of the annotated SC. Within these residues, a cleavable signal peptide (underlined) is predicted by three independent programs (SignalP, PrediSi and LipoP). (B). Distribution of poly-G lengths in the Nichols, Chicago, and Seattle 81–4 treponemes at the moment of bacterial harvest determined by FFLA. (C). FFLA results of the tprL-associated poly-G are shown for the clonal strain Nichols Houston O inoculum and treponemes found in lesions after ID infection with that inoculum. Data are shown for lesions from three rabbits over a three-week infection.
Fig 2

(A). Cartoon depicting the tprL ORF as originally annotated in the T. pallidum Nichols strain [31] (blue) showing the location of the homopolymeric G tract (poly-G), the experimentally determined TSS. Asterisks indicate the newly predicted (*) TprL ribosomal binding site (RBS) and start codon (SC) based on the TSS identification. According to this model, the TprL ORF encompasses 88 additional amino acid residues located upstream of the annotated SC. Within these residues, a cleavable signal peptide (underlined) is predicted by three independent programs (SignalP, PrediSi and LipoP). (B). Distribution of poly-G lengths in the Nichols, Chicago, and Seattle 81–4 treponemes at the moment of bacterial harvest determined by FFLA. (C). FFLA results of the tprL-associated poly-G are shown for the clonal strain Nichols Houston O inoculum and treponemes found in lesions after ID infection with that inoculum. Data are shown for lesions from three rabbits over a three-week infection.

5`-RACE was also performed using Gauthier total RNA but did not yield any reproducible result, suggesting that the TSS of the transcript carrying the tprL message in Gauthier was not in proximity of the primers used. Given the location of the poly-G in the tprL promoter region, we then investigated whether this poly-G showed length variability in vivo within each syphilis strain studied here. To this end, we used a FFLA method based on the amplification of the poly-G repeat with a fluorescent primer and subsequent size separation on a genetic analyzer. The results are shown in Fig 2B. FFLA showed that the length of the tprL-associated poly-G varies in vivo within each isolate. More specifically, the tprL-associated poly-G was shown to contain homopolymeric tracts varying from 7 to 11 Gs, even though the vast majority of the fragments contained 9 Gs. Poly-G length distribution between Chicago and Seattle 81–4 strains was found to be more similar, with a comparable percentage of amplicons containing 8, 9, 10, and 11 Gs, respectively, while no amplicons containing 7 Gs were detected in either strain (Fig 2B).

To corroborate the hypothesis of a possible role for the poly-G in transcriptional regulation of the tprL gene, we investigated whether this repeat varied in length in vivo by monitoring over time changes in the poly-G in the clonal Nichols Houston O isolate using FFLA. Results are shown in Fig 2C. Although the clonal Nichols Houston O isolate used to inoculate rabbits (inoculum, Fig 2C) was found to carry a clonal tprK gene, this strain showed only a near-clonal tprL-associated poly-G, (~81% of promoters had 9 G residues, and ~18.6% had 8 G residues). Promoters with 10 G residues, however, were detected in all subsequent samples from lesions developing in rabbits infected with this inoculum. Additionally, significant variability in the proportion of promoters with 8 and 9 G residues was noted in these samples (Fig 2C). These results demonstrate that the length of the tprL-associated poly-G varies in vivo within an isolate.

Role of poly-G length in transcription

To investigate whether poly-G repeats of different length would affect the activity of the tprL promoter, we adopted an E. coli-based heterologous system that allows monitoring of expression of a vector-encoded GFP reporter gene placed under the control of the tprL promoter with poly-Gs of different length. This approach was previously used to evaluate the role of poly-G repeats in transcription of the tprF, I, E, J, and tp0126 genes, which also encode T. p. pallidum putative OMPs [15,16]. For this study, two different tprL promoters (with poly-Gs of 8 and 10 nt, respectively) were tested along with positive and negative controls (the lac promoter, and a promoter-less reporter vector, respectively). Results (Fig 3) showed that higher GFP fluorescence signal was detected when the tprL promoter carried a poly-G of eight residues compared to 10 G residues, which induced a fluorescence signal slightly above background but not significantly different. This result supports the hypothesis that tprL expression is influenced by phase variation.

Analysis of the effect of poly-G length on tprL transcription.
Fig 3

Analysis of the effect of poly-G length on tprL transcription.

Graph shows fluorescence induced in E. coli TOP-10PE cells transformed with a pGLow-TOPO vector where GFP transcription is under control of the tprL promoters with poly-G tracts of different length (8 and 10 nt). A lac promoter–GFP construct was used as a positive control. The lac promoter is recognized by σ70 and the E. coli strain used for this assay does not carry the gene that encodes the LacI repressor. Background fluorescence collected from E. coli cells transformed with a pGLow-TOPO vector that carries a fragment of T. pallidum Tp0574 ORF with no promoter is also shown. Asterisk (*) indicates significance between the fluorescent level generated by an 8-G construct compared to a 10-G construct. Fluorescence induced by the positive control (lac-GFP) is also significantly higher than the 8-G construct (p = 0.0026).

Humoral response to TprL during experimental and natural infection

Given the apparent lack of elements able to drive translation of TprL in yaws strains, we hypothesized that only syphilis-infected rabbits and patients would develop humoral immunity to TprL when compared to their yaws-infected counterparts. Therefore, we evaluated sera from longitudinally infected rabbits and syphilis patients by ELISA using recombinant TprL. ELISA results using animals infected with the Nichols strain showed limited but detectable reactivity to TprL, which developed relatively late (day 30) post-inoculation (Fig 4A). A more pronounced response to TprL was seen in naturally infected patient samples (Fig 4B). As expected, the vast majority of cases showed a significantly higher reactivity to the Tp0574 antigen, used as a positive control (Fig 4A and 4B). Conversely, no reactivity to TprL was seen in sera from yaws-infected animals or patients, while reactivity to Tp0574 remained readily detectable (Fig 4C and 4D). These results suggest that the deletion naturally occurring in yaws isolates upstream of the TprL ORF might abolish protein expression in this subspecies.

Humoral reactivity to TprL in experimental and clinical samples.
Fig 4

Humoral reactivity to TprL in experimental and clinical samples.

(A) Pooled sera from rabbits (n = 2) infected with T. p. pallidum Nichols strain, and (B) individual sera from syphilis-infected patients. (C) Pooled sera from rabbits (n = 2) infected with T. p. pertenue Gauthier strain, and (D) individual sera from yaws-infected patients. Optical density from test sera in absence of target antigen was used for background subtraction. (E) Reactivity to TprL of sera obtained at day ~30 post-infection (from rabbits infected with T. p. pallidum strains (MexicoA, Chicago, SS14, Bal3, and Sea81-4), and T. p. endemicum (IraqB).

Analysis of the poly-G sequence variability in T. p. pallidum and assessment of tp1030 transcription

Of the 17 targets analyzed, 76% was found to be clearly variable in length, while four appeared to be minimally variable or not variable at all (tp0145, tp0257, tp216, and tp0986) (Fig 5). Poly-Gs of up to ten different lengths (e.g. for the tp0381 gene) could be detected. Assessment of tp1030 transcription using qualitative reverse-transcription PCR suggested that the region immediately upstream of tprL can be transcribed in syphilis strains, but no signal was detected when the Gauthier strain cDNA was used as template (Fig 6A).

Analysis of poly-G tracts not already studied found throughout the T. p. pallidum genome.
Fig 5

Analysis of poly-G tracts not already studied found throughout the T. p. pallidum genome.

Because human treponematoses spirochetes have GC-rich genomes (~52.8%), and poly-G tracts are common, we only selected those showing an initial length ≥8 nt.

(A) RT-PCR analysis of expression of the tp1030 gene in the T.p. pallidum (Nichols, Chicago, and Sea81-4; line 1–3, respectively) and T.p. pertenue (Gauthier; line 4). No amplification was detected in DNaseI-treated RNA samples before reverse transcription (line 5–8). NTC: No template control (line 9). Positive control is Nichols DNA (line 10). M: molecular size marker. Amplification of the control gene tp0574 (encoding the 47 KDa lipoprotein) yielded positive signal from all cDNA samples. (B) Comparison of the TprL NH2-termini of T.p. pallidum and T.p. pertenue (Nichols and Gauthier strains, respectively).
Fig 6

(A) RT-PCR analysis of expression of the tp1030 gene in the T.p. pallidum (Nichols, Chicago, and Sea81-4; line 1–3, respectively) and T.p. pertenue (Gauthier; line 4). No amplification was detected in DNaseI-treated RNA samples before reverse transcription (line 5–8). NTC: No template control (line 9). Positive control is Nichols DNA (line 10). M: molecular size marker. Amplification of the control gene tp0574 (encoding the 47 KDa lipoprotein) yielded positive signal from all cDNA samples. (B) Comparison of the TprL NH2-termini of T.p. pallidum and T.p. pertenue (Nichols and Gauthier strains, respectively).

Discussion

The high global prevalence of syphilis and its resurgence in high-income nations argues in favor of deepening our knowledge of syphilis pathogenesis with the goal of better understanding T. p. pallidum virulence mechanisms, particularly with regard to its ability to persist in the host in absence of treatment [9]. Such knowledge might help devise better strategies for disease control and accelerate vaccine development. Previous studies have clearly shown that antigenic variation of the OMP TprK plays a major role in T. p. pallidum virulence and survival in vivo [24,26,29]. Phase variation is a second, distinct mechanism that has more recently been implicated in T. pallidum virulence based upon our studies. Phase variation allows rapid and reversible ON/OFF switching of gene expression at the transcriptional or translational level to generate phenotypic antigenic diversity during infection. This mechanism is mediated by rapid changes in length of DNA repeats such as homopolymeric tracts due to slipped-strand mispairing during replication. Such elements affect transcription or translation when located within a gene promoter or an ORF, respectively. In pathogens such as N. meningitidis or H. pylori, for example, phase variation influences expression of determinants involved in immune evasion as well as in adaptation to different host microenvironments [4648].

Here, we studied the poly-G associated to the tprL gene to assess whether this gene could also undergo phase variation. Given that TprL is also a putative OMP and conserved among strains and subspecies of T. pallidum, this study is relevant to inform ongoing vaccine development efforts. By identifying the TSS of this gene, we first confirmed that the tprL transcript begins over two hundred nucleotides upstream of the annotated protein start codon [31]. This finding supports that the current annotation of the TprL protein should be revised, as the TprL coding sequence likely includes 88 additional NH2-terminal amino acids, encoded by nucleotides currently annotated as part of the tp1030 gene (Fig 2A), which is either a significantly smaller ORF than originally annotated or, perhaps, a misannotated intergenic region between the tprL gene and tp1029, with the latter encoding a putative helicase. Our preliminary RT-PCR analysis of the genomic region containing the “smaller” tp1030 ORF indicated that this region is transcribed in syphilis isolates. Similar results were provided already by Smajs et al. [14]. This could be an indication that tp1030 is an actual ORF, even though BLASTp, BLASTn, and COGs searches revealed no hits in the database, no evidence of other paralogs was found in T. pallidum subspecies, Pfam searches had no significant hits, and protein domain searches revealed only a very weak similarity of this region to the infected cell protein 0 (ICP0) of herpes simplex virus.

The additional 88-long TprL sequence is, on the contrary, strongly predicted to contain a cleavable signal peptide, which further supports TprL as a putative OMP. Previous attempts to identify a signal peptide on the shorter TprL protein were not successful [44], even though the same studies overall supported TprL as an OMP based on in silico structural homology analysis. Overall, our findings support the necessity to revise the annotation of T. p. pallidum genome using high throughput RNA-seq approaches, which will provide an experimentally determined annotation of the protein-encoding genes, intergenic regions, and organization of ORFs in operons. Necessity to re-annotate based on experimental data was also highlighted by our work on the tp0126 gene, whose signal peptide could be predicted only after determination of the gene TSS exactly as for tprL [15]. Future experiments (e.g. chromatin immunoprecipitation) would also be useful to establish whether other factors might be involved in driving tprL transcription in addition to the likely role of the poly-G. The lack of clear correlation between number of G residues and level of expression seen in vivo suggests in fact that the poly-G could not be the only element involved in transcriptional regulation of this gene. Our previous work showed for example that Tp0262, a T. p. pallidum CRP homolog, was shown to bind specifically to tprE, G, and J promoters containing putative CRP binding motifs and was able to either up-regulate or down-regulate their expression in concert with the length of the poly-G tract associated with these gene promoters [49]. Concerning how the poly-G is able to affect tprL transcription, we compared the tprL phase variation mechanism to that of the porA and opc loci of Neisseria meningitidis, in which the length of the poly-G and the poly-C repeats within their promoters, respectively, controls transcription volume by inducing high to no expression of these genes [50,51]. In the porA promoter, the poly-G tract is clearly between the -10 and -35 signatures, while the opc poly-C region encompasses the -35 sequence. Changes in the poly-G length in the porA promoter abrogates gene transcription when the optimal spacing of 17 nucleotides between the consensus sequences is reduced [50]; in contrast, the poly-C in the -35 sequence most likely modulate transcription of the opc loci by affecting the binding of a regulator that, in turn, affects promoter recognition by the RNA polymerase [47,51]. In the tprL promoter, the poly-G repeat spans part of the -10 region upstream of the TSSs. Consequently, variation in the length of the repeats would not alter the spacing between these signatures, ruling out a porA-like mechanism. Because the tprL poly-G falls into a non-transcribed DNA region, one could hypothesize that variation in the number of Gs might affect conversion of double stranded DNA (closed complex) into single stranded DNA (open complex) driven by the RNA polymerase. However, studies on DNA base pair opening rates attribute an overall higher instability of the double helix to DNA tracts rich in G repeats, which tend to form more planar DNA structures in contrast to A-rich tracts [52]. Furthermore, increases in length of G repeats elevate base pair disassociation constants, suggesting that long poly-G tracts may be particularly unstable [53]. Consequently, a sequence with a high content in G repeats would alter the double helix conformation and decrease the RNA polymerase ability to recognize and bind the DNA region in which the poly-G is contained. According to this hypothesis, it seems plausible that a lower number of Gs within the tprL promoter would decrease the DNA double helix instability, perhaps facilitating the binding of the RNA polymerase to the closed complex and the subsequent formation of the open complex.

In the case of TprL, the newly predicted start would be a CTG codon, based on the location of the RBS. Although CTG is not among the most commonly utilized start codons in bacteria, this is not an unusual finding in spirochetes. Bulach et al. [54], in fact, reported that in Leptospira serovars the frequency of CTG use as a start codon ranges between 17–19%. Another finding worth noting is that in spite of a large deletion affecting its upstream region (Fig 2A), a low transcription level for tprL could be detected in the T. p. pertenue Gauthier strain (Fig 1). It is unclear where the genetic elements responsible for generating this transcript reside in the Gauthier genome, as our attempts to identify them through 5’-RACE failed. However, more importantly, because no humoral reactivity to TprL was seen in yaws-infected rabbits or patients, it is possible that the TprL message is not translated in Gauthier and more generally, the yaws subspecies as a whole. Alternatively, if protein synthesis does occur in yaws treponemes, it might not generate enough antigen to induce a detectable humoral response. Such a finding would have direct implications for development of diagnostic tools for yaws. Due to the aforementioned deletion (shown in Fig 2A), the sequence of the NH2-terminal region of TprL is predicted to diverge from that of syphilis isolates (Fig 6B). Such difference was targeted in the past to try and devise a serological test to differentiate syphilis from yaws infection whenever biological specimens were not suitable for molecular analysis of this region. The possibility of differential diagnosis using TprL-based serological approach, however, could be still feasible based on our results as this antigen might not be synthesized at all during infection with yaws strains. A rapid point-of care test where shared antigens are combined with TprL could indeed help differentiate between these two infections. We acknowledge that the number of pre-clinical samples derived from infected animals and patient specimens used in our study is limited and that we purposely included specimens from patients with confirmed infection with T. p. pertenue based on molecular analysis, and that our findings will need further experimental confirmation using a much larger cohort of patient samples.

In spite of their many commonalities, the pathogenesis of syphilis and yaws also show remarkable differences [18]. If the yaws spirochetes lack a putative OMP and virulence factor such as TprL, as our results here suggest, further studies should try and address the function of this protein and its possible role in the pathogenesis of these infections. Although we hoped to gain clues on TprL function by conducting structural homology analyses, obtaining a consistent model for this protein remains an elusive task, as prediction software Neff-MUSTER, SparksX, HHpred, and HHsearch (all form the LOMETS package), that identify structural homologs to TprL with a beta-barrel structure do not agree on any particular structural homolog. Predictions include electron transport proteins homologous to the Mtr complex of Shewanella baltica [55]; a Type 9 protein translocon homologous to the SprA protein of Flavobacterium johnsoniae [56] which however has a molecular mass three times that of TprL, OmpW of E. coli [57], which however is significantly smaller in size, and a green fluorescent protein of the hydromedusa Aqueora victoria. Further experimental work focusing on the analysis of this protein will shed light on its structure, and provide additional clues to its function and role in disease pathogenesis. Our analysis of the variability of most poly-G tracts found in the Nichols strain genome (Fig 5), strongly suggest that phase variation might be a very strong component of the strategy these spirochetes use to create antigenically distinct cells at the phenotypic level, even though such speculation will need to be experimentally confirmed, and possibly also expanded to the pertenue and endemicum subspecies of T. pallidum. With the exception of the missing tprL-associated poly-G in the pertenue strains, in fact, all the T. pallidum subspecies share the poly-G tracts studied here. In our analysis, only one of the poly-G analyzed here did not vary upon performing amplification and separation, but most of the others showed a rather significant variability in terms of length. These data are an important incentive to perform more studies on the role of the genes to which the poly-G is associated in disease pathogenesis and to the biology of this difficult organism.

Conclusions

Our results support modulation of tprL transcription by phase variation and that this gene might not be functional in yaws treponemes. This information might help vaccine design efforts to control syphilis spread as well as development of diagnostics to differentiate between syphilis and yaws infection.

Acknowledgements

We are grateful to Matthew Golden, MD, MPH for help procuring the syphilis patient sera tested in this study. The content of this study is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

References

WHO. Prevalence and incidence of selected sexually transmitted infections Chlamydia trachomatis, Neisseria gonorrhoeae, syphilis and Trichomonas vaginalis: methods and results used by WHO to generate 2005 estimates. World Health Organization, Geneva 2011.

ACGerbase, JTRowley, TEMertens. Global epidemiology of sexually transmitted diseases. The Lancet. 1998;351 10.1016/s0140-6736(98)90001-0

CDC. 2018 Sexually Transmitted Disease Surveillance. Atlanta, GA: US Department of Health and Human Services: Centers for Disease Control and Prevention 2019.

EJSavage, KMarsh, SDuffell, CAIson, AZaman, GHughes. Rapid increase in gonorrhoea and syphilis diagnoses in England in 2011. Euro Surveill. 2012;17(29). .

EJSavage, GHughes, CIson, CMLowndes. Syphilis and gonorrhoea in men who have sex with men: a European overview. Euro Surveill. 2009;14(47). 10.2807/ese.14.47.19417-en .

ISimms, KAFenton, MAshton, KMTurner, EECrawley-Boevey, RGorton, et al The re-emergence of syphilis in the United Kingdom: the new epidemic phases. Sex Transm Dis. 2005;32(4):2206. 10.1097/01.olq.0000149848.03733.c1 .

JDTucker, MSCohen. China's syphilis epidemic: epidemiology, proximate determinants of spread, and control responses. Curr Opin Infect Dis. 2011;24(1):505. 10.1097/QCO.0b013e32834204bf .

FJin, GPPrestage, SCKippax, CMPell, BJDonovan, JMKaldor, et al Epidemic syphilis among homosexually active men in Sydney. Med J Aust. 2005;183(4):17983. 10.5694/j.1326-5377.2005.tb06989.x .

RELaFond, SALukehart. Biological basis for syphilis. Clin Microbiol Rev. 2006;19(1):2949. 10.1128/CMR.19.1.29-49.2006 .

10 

RLGoldenberg, CThompson. The infectious origins of stillbirth. Am J Obstet Gynecol. 2003;189(3):86173. 10.1067/s0002-9378(03)00470-8 .

11 

MRNusbaum, RRWallace, LMSlatt, ECKondrad. Sexually transmitted infections and increased risk of co-infection with human immunodeficiency virus. J Am Osteopath Assoc. 2004;104(12):52735. Epub 2005/01/18. .

12 

CECameron, SALukehart. Current status of syphilis vaccine development: need, challenges, prospects. Vaccine. 2014;32(14):16029. 10.1016/j.vaccine.2013.09.053 .

13 

FBagnoli, BBaudner, RPMishra, EBartolini, LFiaschi, PMariotti, et al Designing the next generation of vaccines for global public health. Omics. 2011;15(9):54566. 10.1089/omi.2010.0127 .

14 

DSmajs, MMcKevitt, JKHowell, SJNorris, WWCai, TPalzkill, et al Transcriptome of Treponema pallidum: gene expression profile during experimental rabbit infection. J Bacteriol. 2005;187(5):186674. 10.1128/JB.187.5.1866-1874.2005

15 

LGiacani, SLBrandt, WKe, TBReid, BJMolini, SIverson-Cabral, et al Transcription of TP0126, Treponema pallidum putative OmpW homolog, is regulated by the length of a homopolymeric guanosine repeat. Infect Immun. 2015;83(6):227589. 10.1128/IAI.00360-15 .

16 

LGiacani, SLukehart, ACenturion-Lara. Length of guanosine homopolymeric repeats modulates promoter activity of Subfamily II tpr genes of Treponema pallidum ssp. pallidum. FEMS Immunol Med Microbiol. 2007;51:289301. 10.1111/j.1574-695X.2007.00303.x

17 

SDGray-Owen. Neisserial Opa proteins: impact on colonization, dissemination and immunity. Scand J Infect Dis. 2003;35(9):6148. 10.1080/00365540310016042 .

18 

LGiacani, SALukehart. The endemic treponematoses. Clin Microbiol Rev. 2014;27(1):89115. 10.1128/CMR.00070-13 .

19 

M.Janier Ceftriaxone is effective for treating patients with primary syphilis. Sex Transm Dis. 1988;15(1):70 Epub 1988/01/01. .

20 

OMitjà, WHouinei, PMoses, AKapa, RParu, RHays, et al Mass treatment with single-dose azithromycin for yaws. N Engl J Med. 2015;372(8):70310. Epub 2015/02/19. 10.1056/NEJMoa1408586 .

21 

SABaker-Zander, MJFohn, SALukehart. Development of cellular immunity to individual soluble antigens of Treponema pallidum during experimental syphilis. J Immunol. 1988;141(12):43639.

22 

ACenturion-Lara, TArroll, RCastillo, JMShaffer, CCastro, WCVan Voorhis, et al Conservation of the 15-kilodalton lipoprotein among Treponema pallidum subspecies and strains and other pathogenic treponemes: genetic and antigenic analyses. Infect Immun. 1997;65(4):14404. 10.1128/IAI.65.4.1440-1444.1997

23 

LGiacani, KHevner, ACenturion-Lara. Gene organization and transcriptional analysis of the tprJ, tprI, tprG and tprF loci in the Nichols and Sea 81–4 Treponema pallidum isolates. J Bacteriol. 2005;187(17):608493. 10.1128/JB.187.17.6084-6093.2005

24 

RELaFond, BJMolini, WCVan Voorhis, SALukehart. Antigenic variation of TprK V regions abrogates specific antibody binding in syphilis. Infect Immun. 2006;74(11):624451. 10.1128/IAI.00827-06 .

25 

SALukehart, CMMarra. Isolation and laboratory maintenance of Treponema pallidum. Curr Protoc Microbiol. 2007;Chapter 12:7:12A.1.1A.1.8. 10.1002/9780471729259.mc12a01s7 .

26 

LGiacani, BJMolini, EYKim, BCGodornes, BTLeader, LCTantalo, et al Antigenic variation in Treponema pallidum: TprK sequence diversity accumulates in response to immune pressure during experimental syphilis. J Immunol. 2010;184(7):38229. 10.4049/jimmunol.0902788 .

27 

ACenturion-Lara, RELaFond, KHevner, CGodornes, BJMolini, WCVan Voorhis, et al Gene conversion: a mechanism for generation of heterogeneity in the tprK gene of Treponema pallidum during infection. Molecular Microbiology. 2004;52(6):157996. 10.1111/j.1365-2958.2004.04086.x

28 

LGiacani, SLBrandt, MPuray-Chavez, TBrinck Reid, CGodornes, BJMolini, et al Comparative Investigation of the Genomic Regions Involved in Antigenic Variation of the TprK Antigen among Treponemal Species, Subspecies, and Strains. J Bacteriol. 2012;194(16):420825. 10.1128/JB.00863-12 .

29 

TBReid, BJMolini, MCFernandez, SALukehart. Antigenic variation of TprK facilitates development of secondary syphilis. Infect Immun. 2014;82(12):495967. 10.1128/IAI.02236-14 .

30 

FWStudier. Protein production by auto-induction in high density shaking cultures. Protein Expr Purif. 2005;41(1):20734. 10.1016/j.pep.2005.01.016 .

31 

CMFraser, SJNorris, GMWeinstock, OWhite, GGSutton, RDodson, et al Complete genome sequence of Treponema pallidum, the syphilis spirochete. Science. 1998;281(5375):37588. 10.1126/science.281.5375.375

32 

H.Nielsen Predicting Secretory Proteins with SignalP. Methods Mol Biol. 2017;1611:5973. Epub 2017/04/30. 10.1007/978-1-4939-7015-5_6 .

33 

KHiller, AGrote, MScheer, RMünch, DJahn. PrediSi: prediction of signal peptides and their cleavage positions. Nucleic Acids Res. 2004;32(Web Server issue):W3759. Epub 2004/06/25. 10.1093/nar/gkh378

34 

ASJuncker, HWillenbrock, GVon Heijne, SBrunak, HNielsen, AKrogh. Prediction of lipoprotein signal peptides in Gram-negative bacteria. Protein Sci. 2003;12(8):165262. Epub 2003/07/24. 10.1110/ps.0303703

35 

CSYu, CJLin, JKHwang. Predicting subcellular localization of proteins for Gram-negative bacteria by support vector machines based on n-peptide compositions. Protein Sci. 2004;13(5):14026. Epub 2004/04/21. 10.1110/ps.03479604

36 

NYYu, JRWagner, MRLaird, GMelli, SRey, RLo, et al PSORTb 3.0: improved protein subcellular localization prediction with refined localization subcategories and predictive capabilities for all prokaryotes. Bioinformatics. 2010;26(13):160815. Epub 2010/05/18. 10.1093/bioinformatics/btq249

37 

FSBerven, KFlikka, HBJensen, IEidhammer. BOMP: a program to predict integral beta-barrel outer membrane proteins encoded within genomes of Gram-negative bacteria. Nucleic Acids Res. 2004;32(Web Server issue):W3949. Epub 2004/06/25. 10.1093/nar/gkh351

38 

JSöding, ABiegert, ANLupas. The HHpred interactive server for protein homology detection and structure prediction. Nucleic Acids Res. 2005;33(Web Server issue):W2448. Epub 2005/06/28. 10.1093/nar/gki408

39 

PGBagos, TDLiakopoulos, ICSpyropoulos, SJHamodrakas. PRED-TMBB: a web server for predicting the topology of beta-barrel outer membrane proteins. Nucleic Acids Res. 2004;32(Web Server issue):W4004. Epub 2004/06/25. 10.1093/nar/gkh417

40 

LAKelley, SMezulis, CMYates, MNWass, MJSternberg. The Phyre2 web portal for protein modeling, prediction and analysis. Nat Protoc. 2015;10(6):84558. Epub 2015/05/08. 10.1038/nprot.2015.053

41 

JYang, RYan, ARoy, DXu, JPoisson, YZhang. The I-TASSER Suite: protein structure and function prediction. Nat Methods. 2015;12(1):78. Epub 2014/12/31. 10.1038/nmeth.3213

42 

SWu, YZhang. LOMETS: a local meta-threading-server for protein structure prediction. Nucleic Acids Res. 2007;35(10):337582. Epub 2007/05/05. 10.1093/nar/gkm251

43 

LGiacani, BMolini, CGodornes, LBarrett, WCVan Voorhis, ACenturion-Lara, et al Quantitative analysis of tpr gene expression in Treponema pallidum isolates: differences among isolates and correlation with T-cell responsiveness in experimental syphilis. Infect Immun. 2007;75(1):10412. 10.1128/IAI.01124-06

44 

DLCox, ALuthra, SDunham-Ems, DCDesrosiers, JCSalazar, MJCaimano, et al Surface immunolabeling and consensus computational framework to identify candidate rare outer membrane proteins of Treponema pallidum. Infect Immun. 2010;78(12):517894. 10.1128/IAI.00834-10 .

45 

ACenturion-Lara, LGiacani, CGodornes, BJMolini, TBrinck Reid, SALukehart. Fine Analysis of Genetic Diversity of the tpr Gene Family among Treponemal Species, Subspecies and Strains. PLoS Negl Trop Dis. 2013;16(7):e2222 10.1371/journal.pntd.0002222

46 

LSalaun, LASnyder, NJSaunders. Adaptation by phase variation in pathogenic bacteria. Adv Appl Microbiol. 2003;52:263301. 10.1016/s0065-2164(03)01011-6 .

47 

MWvan der Woude, AJBaumler. Phase and antigenic variation in bacteria. Clin Microbiol Rev. 2004;17(3):581611. 10.1128/CMR.17.3.581-611.2004 .

48 

NJSaunders. Evasion of antibody responses: bacterial phase variation. In: BHPCFOyston, editor. Bacterial Evasion of Host Immune Responses. Cambridge: Cambridge University Press; 2003 p. 10324.

49 

HSkarin, ALindberg, GBlomqvist, AAspan, VBaverud. Molecular characterization and comparison of Clostridium botulinum type C avian strains. Avian Pathol. 2010;39(6):5118. 10.1080/03079457.2010.526923 .

50 

Avan der Ende, CTHopman, SZaat, BBEssink, BBerkhout, JDankert. Variable expression of class I outer membrane protein in Neisseria meningitidis is caused by variation in the spacing between the -10 and -35 regions of the promoter. J Bacteriol. 1995;177(9):247580. 10.1128/jb.177.9.2475-2480.1995 .

51 

JSarkari, NPandit, ERMoxon, MAchtman. Variable expression of the Opc outer membrane protein in Neisseria meningitidis is caused by size variation of a promoter containing poly-cytidine. Mol Microbiol. 1994;13(2):20717. 10.1111/j.1365-2958.1994.tb00416.x .

52 

UDornberger, MLeijon, HFritzsche. High base pair opening rates in tracts of GC base pairs. J Biol Chem. 1999;274(11):695762. 10.1074/jbc.274.11.6957 .

53 

CDBayliss, KMDixon, ERMoxon. Simple sequence repeats (microsatellites): mutational mechanisms and contributions to bacterial pathogenesis. A meeting review. FEMS Immunol Med Microbiol. 2004;40(1):119. 10.1016/S0928-8244(03)00325-0 .

54 

DMBulach, TSeemann, RLZuerner, BAdler. The Organization of Leptospira at a Genomic Level. In: VLChan, PMSherman, BBourke, editors. Bacterial Genomes and Infectious Diseases. Totowa, NJ: Humana Press; 2006 p. 10923.

55 

MJEdwards, GFWhite, JNButt, DJRichardson, TAClarke. The Crystal Structure of a Biological Insulated Transmembrane Molecular Wire. Cell. 2020;181(3):66573.e10. Epub 2020/04/15. 10.1016/j.cell.2020.03.032

56 

FLauber, JCDeme, SMLea, BCBerks. Type 9 secretion system structures reveal a new protein transport mechanism. Nature. 2018;564(7734):7782. Epub 2018/11/09. 10.1038/s41586-018-0693-y

57 

FHagn, MEtzkorn, TRaschle, GWagner. Optimized phospholipid bilayer nanodiscs facilitate high-resolution structure determination of membrane proteins. J Am Chem Soc. 2013;135(5):191925. Epub 2013/01/09. 10.1021/ja310901f