Colony sampling

A total of 333 nests of M. triviale were collected from 14 local populations in Japan (Fig 1, Table 1). No specific permission for sampling was required. In the field, nests were found in small gaps in dead plant bodies such as rotten roots, dead twigs, hollow bamboo sticks, and acorns. Because of the small nest size (about 200 workers on average) it was easy to collect the whole nest. During the field investigation, males of M. triviale were never found. Colonies were transferred into artificial nests in the laboratory as soon as possible and were kept at 25°C until the following experiments. In addition, ethanol-preserved samples originating from three other sites were examined (Fig 1, nos. 15 to 17).

Fig 1

Localization of the 14 sampling sites (1 to 14) and the three sites of origin of laboratory-reared populations (15 to 17) in Japan.

Open circles indicate site locations. Site names, numbers of nests collected, and types of analyses are described in Table 1. Map data by Natural Earth (http://www.naturalearthdata.com/).

Table 1

Sampling sites of Monomorium triviale populations and experiments performed.

	Locality	Latitude	Longitude	Collection dates	No. of nests	Experiments
1	Kyoto City, Kyoto Prefecture	35.060087	135.788488	19/04/2017 to 27/11/2017 (24 times)	176	SP, VR, SEQ
2	Tsuchiura City, Ibaraki Prefecture	36.077927	140.165473	20/06/2017, 09/10/2018	28	SP, VR, SEQ
3	Chofu City, Tokyo Metropolis	35.668182	139.549061	16/06/2017, 27/09/2018	28	SP, VR, SEQ
4	Tsukuba City, Ibaraki Prefecture	36.100415	140.101297	19/06/2017, 08/10/2018	26	SP, VR, SEQ
5	Otsu City, Shiga Prefecture	34.970262	135.956026	10/06/2017	26	SP, VR, SEQ
6	Matsudo City, Chiba Prefecture	35.774787	139.899362	18/06/2017, 28/09/2018	22	SP, VR, SEQ
7	Higashiosaka City, Osaka Prefecture	34.665748	135.671267	09/11/2017	5	SP, SEQ
8	Okazaki City, Aichi Prefecture	34.941529	137.175594	03/09/2017	1	SP, SEQ
9	Sanda City, Hyogo Prefecture	34.914575	135.165764	09/05/2017	1	VR, SEQ
10	Kaizu City, Gifu Prefecture	35.22	136.63	06/06/2018	1	SP
11	Tobishima Island, Sakata City, Yamagata Prefecture	39.19	139.55	20/09/2018	2	SP
12	Takamatsu City, Kagawa Prefecture	34.364349	134.098205	17/06/2017	16	SEQ
13	Matsuyama City, Ehime Prefecture	33.845539	132.765722	19/09/2018	2	SEQ
14	Takashima City, Shiga Prefecture	35.3677	135.9168	30/05/2017	1	SEQ
15	Kanonji City, Kagawa Prefecture	34.12	133.66	Reared in Laboratory	–	SEQ
16	Kagamihara City, Gifu Prefecture	35.40	136.85	Reared in Laboratory	–	SEQ
17	Matsue City, Shimane Prefecture	35.47	133.05	Reared in Laboratory	–	SEQ
				Total	333

The nests from Kaizu City (locality no. 10) and Tobishima Island (no. 11) were provided by Dr. K. Ohkawara. Samples from Higashiosaka City (no. 7) and Takashima City (no. 14) were provided by Mr. K. Sadahiro and Dr. T. Nozaki, respectively. Ethanol-preserved samples from Kanonji City, Kagamihara City, and Matsue City (nos. 15 to 17) were provided by Dr. F. Ito. Experiments on the samples from the 17 sites are abbreviated as follows: SP: Dissection of wild queens’ spermathecae; VR: Observation of virgin queen reproduction; SEQ: Phylogenetic analysis based on mtDNA sequencing.

Dissection of wild queens

To confirm the reproductive status of the queens from wild nests, we dissected 63 individuals from 38 nests of 10 M. triviale populations within 6 months after collection (Table 2). First the queen was immobilized by soaking in 70% ethanol for 3 min. The body was then transferred to a 30-mm petri dish filled with distilled water, and the internal reproductive organs were pulled out from the end of the abdomen by using precision forceps under a binocular microscope (SZ40; OLYMPUS Optical, Tokyo, Japan). The mating status of the queen was determined by the presence or absence of sperm in the spermatheca. As an indicator of oviposition, the ovary’s yellow body was checked. As a positive control [18], 11 queens of a congeneric species, M. intrudens, were dissected in the same manner.

Table 2

Dissected queens from each sampling site.

				Insemination		Yellow body
	Locality	No. of nests	No. of queens	yes	no	yes	unclear
1	Kyoto City, Kyoto Prefecture	3	10	0	10	9	1
2	Tsuchiura City, Ibaraki Prefecture	8	8	0	8	7	1
3	Chofu City, Tokyo Metropolis	8	8	0	8	5	3
4	Tsukuba City, Ibaraki Prefecture	8	8	0	8	3	5
5	Otsu City, Shiga Prefecture	2	9	0	9	9	0
6	Matsudo City, Chiba Prefecture	4	8	0	8	8	0
7	Higashiosaka City, Osaka Prefecture	1	1	0	1	1	0
8	Okazaki City, Aichi Prefecture	1	8	0	8	8	0
10	Kaizu City, Gifu Prefecture	1	1	0	1	1	0
11	Tobishima Island, Sakata City, Yamagata Prefecture	2	2	0	2	1	1
	Total	38	63	0	63	52	11
–	Monomorium intrudens, Kyoto City, Kyoto Prefecture	4	11	10	1	11	0

The numbers of individuals possessing a yellow body and presumed to have experienced oviposition are also shown. As a positive control, data for the sexual congener M. intrudens are shown in the bottom row.

Rearing experiment

Each wild nest was put into a plastic container (68 × 39 × 15 mm) with gypsum on the bottom. The nests were kept in the laboratory at 25°C, and water and food were replenished every 3 days. The nests were fed mealworms, Tenebrio molitor, cut into approximately 5-mm lengths. During July and August 2017, a total of 44 queen broods (larvae or pupae) from 21 nests of seven populations were produced (Table 3). Each queen was isolated with 10 nestmate workers in a plastic container (36 × 36 × 14 mm). These nests were kept under the same conditions as the source nests. Reproduction by these virgin queens was observed for 6 months. Finally, all remaining queens were dissected and confirmed to have no sperm in their spermathecae (Table 4).

Table 3

Thelytokous worker production in the rearing experiment.

	Locality	No. of nests	No. of queens isolated	No. of queens surviving for 6 months	No. of workers produced
1	Kyoto City, Kyoto Prefecture	6	10	6	17
2	Tsuchiura City, Ibaraki Prefecture	3	7	2	11
3	Chofu City, Tokyo Metropolis	3	5	5	26
4	Tsukuba City, Ibaraki Prefecture	3	5	5	28
5	Otsu City, Shiga Prefecture	3	8	8	52
6	Matsudo City, Chiba Prefecture	2	7	8	28
9	Sanda City, Hyogo Prefecture	1	2	2	15
	Total	21	44	36	177

Table 4

Dissection of virgin queens from the rearing experiment.

		No. of queens dissected	Insemination		Yellow body
	Locality		yes	no	yes	unclear
1	Kyoto City, Kyoto Prefecture	0a	NA	NA	NA	NA
2	Tsuchiura City, Ibaraki Prefecture	2	0	2	2	0
3	Chofu City, Tokyo Metropolis	5	0	5	3	2
4	Tsukuba City, Ibaraki Prefecture	5	0	5	2	3
5	Otsu City, Shiga Prefecture	8	0	8	3	5
6	Matsudo City, Chiba Prefecture	7	0	7	2	5
9	Sanda City, Hyogo Prefecture	2	0	2	1	1
	Total	29	0	29	13	16

^aWe did not examine queens from Kyoto due to their death before dissection.

Microsatellite analysis

To provide genetic evidence of thelytoky, 33 queens (from 17 nests of seven populations; all used in the rearing experiment) were examined (Table 5). They were genotyped at microsatellite locus Mp-1 (f: GCCAATGGTTTAATCCCTCA; r: TCATACTGCGTGTGCCTTTC), originally developed from M. pharaonis [24]. Daughter workers produced from these virgin queens (174 individuals in total) were also genotyped and were compared with their mothers. The thorax of each individual was crushed and placed in a 0.2-mL microtube filled with 100 μL of a DNA extraction reagent (PrepMan Ultra Reagent, Applied Biosystems, Foster City, CA, USA). The polymerase chain reaction (PCR) cocktail contained 1 μL of template DNA, 0.3 μL of 25 mM MgCl₂, 0.3 μL of 10 mM dNTPs, 1.5 μL of 10× PCR Buffer, 0.1 μL of 5 U/μL Taq DNA Polymerase (QIAGEN, Valencia, CA, USA), 0.2 μL of U19 fluorescent dye, and 1.0 μL of each primer pair, to which distilled water was added to make a total volume of 15.2 μL. The PCR program consisted of an initial step of 94°C for 180 s, followed by 35 cycles of 94°C for 30 s, 57°C for 60 s and 72°C for 60 s, with a final step of 72°C for 10 min. PCR products were mixed with Hi-Di formamide and GS-600 LIZ size standard and were analyzed by using a 3500 Series Genetic Analyzer and GeneMapper 5.0 software (Applied Biosystems).

Table 5

Microsatellite analysis data.

	Locality	No. of nests	No. of queens	No. of workers	Genotype	Prob. that all offspring were heterozygous
1	Kyoto City, Kyoto Prefecture	4	4	15	222/234	(1/2)15 = 3.05 ×10−5
2	Tsuchiura City, Ibaraki Prefecture	1	2	11	220/232	(1/2)11 = 4.88 ×10−4
3	Chofu City, Tokyo Metropolis	3	5	26	222/232	(1/2)26 = 1.49 ×10−8
4	Tsukuba City, Ibaraki Prefecture	3	5	28	220/232	(1/2)28 = 3.73 ×10−9
5	Otsu City, Shiga Prefecture	3	8	52	220/228	(1/2)52 = 2.22 ×10−16
6	Matsudo City, Chiba Prefecture	2	7	27	220/234	(1/2)27 = 7.45 ×10−9
9	Sanda City, Hyogo Prefecture	1	2	15	222/238	(1/2)15 = 3.05 ×10−5
	Total	17	33	174	–	(1/2)174 = 4.18 ×10−53

Genotypes at the Mp-1 locus are shown. Under the assumption of sexual reproduction, the probability that all daughter workers would be heterozygous was calculated.

Microbial analysis

To assess potential infection of M. triviale by thelytoky-inducing bacteria, we performed high-throughput amplicon sequencing by using whole bodies of adults. In August 2020, three M. triviale nests were collected in Takaragaike Park, Kyoto, Japan (lat 35.060087, long 135.788488). All colonies were transported to our laboratory and moved to plastic containers (68 × 39 × 30 mm) with gypsum on the bottom. They were maintained at 25°C, and water replenishment and mealworm-feeding were performed every 3 days. In October 2020, ten queens and 100 workers were picked up from each nest. The queens or workers from each nest were stored as a group in acetone at –30°C. The pooled individuals represented one biological replicate (i.e., three replicates per caste). Whole bodies in each replicate were air-dried and pooled in a 1.5-mL plastic tube, and DNA was extracted with a QIAamp DNA Micro Kit (QIAGEN). We followed the manufacturer’s instructions and added extra steps of thermal cycling and lysozyme to the protocol to ensure the lysis of Gram‐positive bacterial cell walls: After being crushed in 180 μL ATL buffer, samples in plastic tubes first underwent two cycles of −80°C for 30 min and 50°C for 5 min; then, under room temperature, we added 2 μL of lysozyme from egg white (Nakalai Tesque, Kyoto, Japan; 20 μg/μL TE buffer) to each sample and incubated the samples at 37°C for 30 min.

16S rRNA amplicon sequencing and the subsequent data analysis were performed according to in‐house workflow by Bioengineering Lab. Co., Ltd. (Sagamihara, Kanagawa, Japan). The V4 region was amplified from 1 ng of template DNA by using ExTaq HS (Takara Bio, Otsu, Shiga, Japan) polymerase and the 515f–806r primer pair. Sequences were determined by using a MiSeq system with a MiSeq reagent kit v3 (Illumina, San Diego, CA, USA), which generated 2 × 300-bp paired‐end reads.

Demultiplexing (on the basis of a perfect match with the primer sequences used), adapter trimming, and quality filtering (phred score ≥ 20; primer sequences, 50 bp on both 3ʹ-ends, noise and chimeric reads were removed) of the paired-end reads were performed by using a Fastx toolkit (ver. 0.0.14, http://hannonlab.cshl.edu/fastx_toolkit/) and dada2 plugin for Qiime2 (ver. 2020.8) [25], resulting in representative sequences and operational taxonomic unit (OTU) tables. Assignment of appropriate taxa (confidence level > 0.7) was performed by using the default setting of the feature-classifier plugin for Qiime2 against the EzBioCloud 16S reference database (https://www.ezbiocloud.net/).

Phylogenetic analysis

To investigate intraspecific diversity and determine the phylogenetic position of M. triviale, phylogenetic analysis was performed. A 639-bp region of the cytochrome oxidase I (COI) sequence was determined by using PCR with a combination of primers, namely LCO1490 (GGTCAACAAATCATAAAGATATTGG) and HCO2198 (TAAACTTCAGGGTGACCAAAAAATCA) [26]. One worker randomly chosen from each of 15 local populations (Table 1) of M. triviale and a single worker of the sexual species, M. intrudens, collected in Kihoku-cho, Mie, Japan (lat 34.21, long 136.33), were sequenced. Protocols for DNA extraction and the PCR mix were the same as for the microsatellite analysis. The thermal cycle consisted of an initial denaturation at 94°C for 1 min, 35 cycles of denaturation at 94°C for 30 s, annealing at 50°C for 30 s, extension at 72°C for 60 s, and a final extension at 72°C for 10 min. PCR products were ethanol-precipitated and sequenced in both directions by using a BigDye Terminator v3.1 cycle sequencing kit on a 3500 Series Genetic Analyzer (Applied Biosystems). A total of 16 sequences were submitted to the DNA Data Bank of Japan under accession numbers LC592050 to LC592065; see Fig 3). To identify the phylogenetic position of M. triviale after recent advances in systematics of the subfamily Myrmicinae [27], a congeneric species, M. pharaonis (GenBank accession number GU710434) and two former Monomorium species, Syllophopsis sechellensis (EF609858) and Erromyrma latinodis (GU709833) were added to the analysis. The red imported fire ant, Solenopsis invicta (HQ928672), was used as an outgroup. The 16 sequences, together with those of the above four species, were aligned by using ClustalW [28] in MEGA 10.0 [29]. Maximum likelihood analyses were conducted as implemented in MEGA 10.0 by using a GTR+I+Γ model with node support assessed with 1000 bootstrap replicates.

Dissection of wild queens

All 63 dissected queens of M. triviale had no sperm in their spermathecae (Fig 2, Table 2). Yellow bodies, suggestive of queen oviposition experience, were identified in 52 individuals across all 10 sampling sites. In contrast, 10 out of 11 M. intrudens queens dissected as positive controls had sperm in their spermathecae. Dissection of M. triviale workers confirmed their complete sterility (S1 File), indicating that their complete sterility reported in previous studies [30, 31].

Fig 2

Reproductive organs of (a) Monomorium triviale and (b) M. intrudens queens. (a) M. triviale: Translucent (empty) spermatheca (spt), ovarioles with oocytes and obvious yellow bodies (yb) indicating that virgin queens were reproductively mature and laid eggs. (b) M. intrudens: Opaque (filled with sperm) spermatheca, well-developed ovarioles, and yellow bodies indicating that the queen is sexually reproducing. Yellow arrowheads indicate yellow bodies.

Rearing experiment

Eight queens died before producing daughter workers (Table 3). Thirty-six virgin queens from seven local populations survived, and each produced at least one worker. In total, 177 workers emerged during the experimental period; no males were produced. All dissected queens had empty spermathecae (Table 4). Despite all the queens producing workers, only 13 of 29 queens dissected had obvious yellow bodies.

Microsatellite analysis

Analysis of 33 queens and 174 workers showed that all individuals were heterozygous at Mp-1 and that the genotypes of all the daughter workers were identical to those of their mothers. In addition, all individuals within the same local population had the same genotype. Comparison of genotypes between mothers and their daughters enables us to infer the occurrence of sexual reproduction. A potential male mate of a heterozygous mother (genotype AB) either shares or does not share the same allele (A or B) of Mp-1 as the mother. We can rule out the latter possibility on the basis of the daughter genotypes. In the former case, the mother’s sexually produced daughters should have two genotypes in the expected ratio of 1:1. One is the same as their mother’s (AB) and the other is homozygous at one of the two mother alleles (AA when the father’s genotype is A, or BB when the father’s genotype is B). Under sexual reproduction, the observed bias toward the daughter’s same heterozygous genotypes as their mother would be extremely rare. (The exact binomial probabilities are given in Table 5.) Therefore, we can reject the possibility of sexual reproduction among the individuals that we genotyped.

Microbial analysis

MiSeq sequencing and Qiime2-based analysis yielded 8364 to 46,817 reads per biological replicate and a total of 267 OTUs (summarized in S1 Table). Among them, 263 OTUs (covering 99.9% to 100% of the reads) were classified as bacterial, and 117 OTUs (92.4% to 99.5% of the reads, excepting 54.7% of the reads from one queen replicate from nest B, see below) were classified at least to the phylum level. No reads were assigned to bacterial genera that are known to induce thelytokous parthenogenesis in Hymenoptera, i.e., Cardinium, Rickettsia, and Wolbachia [1].

In two nests (A and C) out of the three replicates for both queens and workers, the most abundant reads were classified as from Spiroplasma platyhelix (88.4% and 67.4% of total reads from queen and worker replicates, respectively, of nest A; 91.5% and 91.1%, respectively, for nest C). The replicates obtained from nest B showed a different pattern of S. platyhelix abundance: 0% from the queen replicate and 13.2% from the worker replicate. The absence of the S. platyhelix sequence from the nest B queen replicate was likely associated with the relatively small number of total reads (8364 vs. >30,000, S1 Table).

Phylogenetic analysis

The 639-bp partial sequences of COI were completely identical among all individuals representing 15 populations of M. triviale (Fig 3). These individuals were placed in the monophyletic group with M. intrudens and M. pharaonis. Although the genus Monomorium has recently been revealed to be a polyphyletic group [27, 32], our result suggests that M. triviale belongs to the genus Monomorium sensu stricto.

Fig 3

Maximum likelihood tree of 15 populations of M. triviale and related species, based on COI sequences.

The number at each branch of the phylogenetic tree represents the bootstrap percentage (1000 replicates). GenBank accession codes follow the taxon names. Scale bar: 0.1 substitutions per site.