PLoS Pathogens
Home PspC domain-containing protein (PCP) determines Streptococcus mutans biofilm formation through bacterial extracellular DNA release and platelet adhesion in experimental endocarditis
PspC domain-containing protein (PCP) determines <i>Streptococcus mutans</i> biofilm formation through bacterial extracellular DNA release and platelet adhesion in experimental endocarditis
PspC domain-containing protein (PCP) determines Streptococcus mutans biofilm formation through bacterial extracellular DNA release and platelet adhesion in experimental endocarditis

The authors have declared that no competing interests exist.

Article Type: Research Article Article History
  • Altmetric
Abstract

Bacterial extracellular DNA (eDNA) and activated platelets have been found to contribute to biofilm formation by Streptococcus mutans on injured heart valves to induce infective endocarditis (IE), yet the bacterial component directly responsible for biofilm formation or platelet adhesion remains unclear. Using in vivo survival assays coupled with microarray analysis, the present study identified a LiaR-regulated PspC domain-containing protein (PCP) in S. mutans that mediates bacterial biofilm formation in vivo. Reverse transcriptase- and chromatin immunoprecipitation-polymerase chain reaction assays confirmed the regulation of pcp by LiaR, while PCP is well-preserved among streptococcal pathogens. Deficiency of pcp reduced in vitro and in vivo biofilm formation and released the eDNA inside bacteria floe along with reduced bacterial platelet adhesion capacity in a fibrinogen-dependent manner. Therefore, LiaR-regulated PCP alone could determine release of bacterial eDNA and binding to platelets, thus contributing to biofilm formation in S. mutans-induced IE.

Phage shock proteins (Psps) are well-characterized in Gram-negative bacteria, yet their roles in Gram-positive were yet unknown. Interestingly, we found a PspC homolog [named PspC domain-containing protein (PCP) in this study] that is well preserved and conserved among pathogenic streptococci, including S. pneumonia and group A and group B streptococci. Using a rat experimental endocarditis infection model and S. mutans as a representative pathogen, we demonstrated PCP alone could mediate bacterial colonization and biofilm formation in situ. Therefore, PCP codes for an essential gene controlling biofilm formation in vivo for S. mutans and possibly other pathogenic streptococci.

Jung,Hsu,Chen,Cheng,Yuan,Kuo,Hsu,Chia,and Orihuela: PspC domain-containing protein (PCP) determines Streptococcus mutans biofilm formation through bacterial extracellular DNA release and platelet adhesion in experimental endocarditis

Introduction

Bacterial biofilm formation determines not only pathogenesis, but also antibiotic resistance upon colonizing host microenvironments to cause infectious diseases. Yet, the adaptation of bacteria or components responsible for forming biofilm in vivo have remained largely unclear. A typical example is infective endocarditis (IE), which is a biofilm-associated disease and most frequently caused by staphylococci or oral streptococci [1,2]. Previously, we demonstrated these IE pathogens can hijack platelets and neutrophil extracellular traps (NETs) to promote biofilm and vegetation formation [35]. In addition, plasma components can enhance Streptococcus mutans survival in the blood circulation and modulate bacterial biofilm formation through enhancing autolysin maturation for releasing bacterial extracellular DNA (eDNA), which is an important matrix component of biofilm on the damaged heart valve in vivo [6]. These data suggested that host factors can modulate bacterial virulence causing IE, but the bacterial regulatory components responsible for regulating bacterial virulence for causing IE remain unclear.

Bacteria adapt to environmental stimulations and regulate downstream gene expression through two component systems (TCSs) [7]. TCSs typically consist of a sensor kinase and a response regulator, which is generally a DNA-binding protein that modulates the expression of target genes [8,9]. Although sensor kinases and response regulators are usually paired and localized in operons, they also crosstalk with other TCSs for regulating bacterial gene expression in response to a variety of environmental stimuli. Bioinformatic analysis of the S. mutans UA159 genome sequence identified 13 putative TCS (TCS-1 to TCS-13) and one orphan response regulator (GcrR or CovR) in S. mutans [10]. Among these TCSs, the role of several in bacterial biofilm formation has been demonstrated, including TCS-1 (VicKR) [11], TCS-2 (CiaHR) [10], TCS11 (LiaRS) [12], TCS-13 (ComDE) [13], and GcrR [14]. In vitro, these TCSs have been shown to regulate biofilm formation by regulating glucosyltransferase (Gtf) systems, which control the sucrose-mediated glucan production crucial for S. mutans biofilm formation on polystyrene and dental surfaces [11,15]. However, there is no sucrose in plasma, and glucosyltransferase-deficient strains do not reduce their abilities to cause IE [16], suggesting S. mutans exploit other bacterial or host components, instead of glucan, to form biofilms on heart valves in IE. Consistently, our previous study demonstrated that platelets and bacterial eDNA play important roles in S. mutans biofilm formation on the heart valve in IE [6]. The data suggested novel TCS-regulated components in S. mutans may determine biofilm formation in vivo.

In this study, using in vivo survival assay and microarray analysis, we identified LiaR plays an essential role in biofilm formation on damaged heart valves in situ in an experimental IE rat model. The underlying mechanisms mainly involved novel phage shock protein C (PspC) domain-containing protein (PCP)-mediated eDNA release and platelet adhesion capacities. In addition, PCP is well conserved in other streptococcal pathogens, implying their essential roles in pathogenesis through modulating biofilm formation.

Results

LiaR-deficient S. mutans has reduced ability to cause vegetation in vivo

Two component systems sense environmental cues and responses by rapidly regulating gene expression. To identify essential genes of S. mutans in vivo, an in situ biofilm formation was screened on damaged heart valves using a panel of isogenic mutant strains of S. mutans TCS with unknown functions, including SMU.1146, SMU.927, SMU.1815, SMU.659, SMU.1038, SMU.1008, SMU.1964, SMU.576, SMU.487, and SMU.1547 [10] via intravenous infection (Fig 1A). Briefly, a mixture of 10 transcription regulator isogenic mutant strains of S. mutans [108 colony forming unit (CFU)/each] were infected into catheterized rats, and each mutant strain in the mixture could be recognized by specific primers (Table 1; Fig 1B, upper panel). Twenty-four hours after infection, the bacteria colonized inside the vegetation were harvested and identified using specific primers (Fig 1B, bottom panel). Interestingly, SMU.487 (also named liaR)-deficient bacteria were hardly found in the harvested bacterial mixture. To confirm the role of LiaR in the pathogenesis of S. mutans-induced IE, the liaR-deficient strains of S. mutans UA159 and GS5 were tested for their virulence in the experimental rat IE model. LiaR-deficient strains exhibited a significantly reduced ability to colonize on heart valve and form biofilm-related septic thrombi (vegetation) compared with the parental strain (Fig 1C and 1D, S1 Fig and S2 Fig). Complementation of the liaR gene into liaR-deficient strains restored the phenotype, confirming the role of LiaR (Fig 1C and 1D, S1 Fig and S2 Fig). These data suggest LiaR regulates S. mutans virulence in the pathogenesis of IE.

LiaR-deficient mutant strain shows reduce ability to cause vegetation formation in experimental rat IE model.
Fig 1

LiaR-deficient mutant strain shows reduce ability to cause vegetation formation in experimental rat IE model.

(A) Schematic diagram of in vivo survival assay. A mix of 10 insertion mutants of transcription regulators was injected (108 for each) into catharized rats, and the bacteria colonized inside the vegetation on damaged valves were identified by specific primers. (B) The upper panel is a representative PCR result of injected bacterial mixtures (input PCR); the bottom panel is a representative PCR result of bacteria colonized inside the vegetation. M, DNA marker; lane 1, the PCR result using the primers for detecting SMU.1146-deficient mutant; lane 2, SMU.927; lane 3, SMU.1815; lane 4, SMU.659; lane 5, SMU.1038; lane 6, SMU.1008; lane 7, SMU.1964; lane 8, SMU.576; lane 9, SMU.487 (LiaR); lane 10, SMU.1547; and PC, positive control, PCR product of 16S rRNA gene. (C and D) The role of LiaR in the pathogenesis of S. mutans-induced IE was investigated using ΔliaR and comΔliaR strains of GS5 and UA159 in experimental rat endocarditis models. The number of colonized bacteria inside vegetations (C) and vegetation size (D) were measured. Data represent the means ± standard error of the means and were statistically analyzed using the Kruskal-Wallis test with subsequent Dunn’s test; *P < 0.05, ns, not significant. IE, infective endocarditis; PCR, polymerase chain reaction; and CLSM, confocal laser scanning microscopy.

Table 1
PCR primers used in the current study.
PrimersSequence (5’ to 3’) (restriction sites: underlined)Target
For bacteria identification in in vivo survival assay
EMRGCGTGTTCATTGCTTGAErythromycin cassette
EMFCCGTTTACGAAATTGGAAC
SMU.1146-RAAATCGTTTAGTGTCCTGTCwith EMF; SMU.1146-insetion mutant
SMU.927-FCGATATCAAGAACCCAGAwith EMR; SMU.927-insertion mutant
SMU.1815-RGTCCTAGCTAAACGTGGAwith EMF; SMU.1815-insertion mutant
SMU.659-FCATTATGGATGGTGGAACwith EMR; SMU.659-insertion mutant
SMU.1038-RGCTTGCTGGCTATAGATGwith EMF; SMU.1038-insertion mutant
SMU.1008-FCTTTCAGAAGGAACACAAGwith EMR; SMU.1008-insertion mutant
SMU.1964-FAATAAGGTTAACAGGGCTCwith EMR; SMU.1964-insertion mutant
SMU.576-FATAAGCTGAGAAACGAGCwith EMR; SMU.576-insertion mutant
SMU.487-RAGCTTTGTCTTTACCAGCwith EMF; SMU.487-insertion mutant
SMU.1547-FCCGTCTATCAACCTTAGCwith EMR; SMU.1547-insertion mutant
SMU.1128-FGCTTCTTCAAGTATCGACAwith EMR; SMU.1128-insertion mutant
SMU.1145-FTTACGAAGCTTGAAGACTGwith EMR; SMU.1145-insertion mutant
SMU.1814-FATGCCAATGACTTACTGCwith EMR; SMU.1814-insertion mutant
SMU.1037-FCTCGGATTTATCGTCATCwith EMR; SMU.1037-insertion mutant
SMU.1009-RGTAAGTGAACGGAACAGAAwith EMF; SMU.1009-insertion mutant
SMU.1965-RGTTGTGCCCGTTGAATTAAwith EMF; SMU.1965-insertion mutant
SMU.577-RCAGCAGTTCATTTATCTCCwith EMF; SMU.577-insertion mutant
SMU.486-FATCTATGGCTATGTTCGCwith EMR; SMU.486-insertion mutant
SMU.1548-RGACAGCTACCGGTCTTACwith EMF; SMU.1548-insertion mutant
For generation of deletion mutants and the complementation strains
liaR-BFGCTCAGAATGACTTGCGAGupstream fragment of liaR
liaR-BR-EcoRIGGAATTCCTTTTGTTTTACTCATCAGCA
liaR-AF-EcoRIGGAATTCCATCATTTAGTGCCACAGGdownstream fragment of liaR
liaR-ARAGCTTTGTCTTTACCAGC
pcp-BFACAAACAACAGGCGGACupstream fragment of pcp
pcp-BR-EcoRIGGAATTCCACAACTCCGCAGATCA
pcp-AF-EcoRIGGAATTCCATCGTCATGCTCAAGGGdownstream fragment of pcp
pcp-ARGATAATGGCTGGTGTTTCA
pcpPF-XbaIGCTCTAGAGCTGAATCGTGTGGTCAAGTpcp
pcpR-XbaIGCTCTAGAGCTTACCAAAACCATTTGTTAT
Construction of recombinant LiaR
liaRF-BamHICGGGATCCCGTGCTGATGAGTAAAACAAAAliaR
liaRR-BamHICGGGATCCCGCTAATTTTCGTCCTGTGG
RT-PCR and CHIP-PCR of pcp
pcpFGGTAGTATGATCTGCGGApcp
pcpRCCTTGAGCATGACGATAA
16S-FAGAGTTTGATCMTGGCTCAG16S rRNA gene
16S-RGGTTACCTTGTTACGACTT

LiaR regulates PCP-mediated biofilm formation in vivo

To observe bacterial biofilm formation on damaged heart valves in vivo, a green fluorescent protein (GFP)-tagged S. mutans GS5 strain was used in the experimental IE model [3]. Consistently, the liaR-deficient strain showed reduced ability to form biofilms on the damaged valve in situ compared with the parental strain (Fig 2A and S3 Fig). To identify LiaR-regulated downstream genes, microarray analysis was performed (S1 Table). Notably, among the LiaR-regulated genes, expression of SMU.753, which encodes a PspC domain-containing protein (named PCP here) [17], was dramatically reduced in the liaR-deficient mutant strain (S1 Table). Data from reverse transcriptase (RT)- and chromatin immunoprecipitation (ChIP)-polymerase chain reaction (PCR) assays confirmed LiaR can directly bind the promoter region to regulate expression of pcp (Fig 2B and 2C). The Pcp-deficient mutant also showed a reduced ability to colonize and form a biofilm on the damaged valve (Fig 2A, 2D and S3 Fig), with reduced vegetation formation size (Fig 2E, S1 Fig and S2 Fig) in the experimental rat IE model. PspC is a member of the Psp stress response system, which contains four core components (PspF, -A, -B, and -C) and modulates the bacterial stress response in Gram-negative bacteria, such as Escherichia coli and Yersinia enterocolitica [18]. However, S. mutans and other streptococci only contained a PspC homolog (PCP) and did not have other Psp operon genes compared with Y. enterocolitica (Fig 3A). A comparison of amino acid sequences with PCPs of the other pathogen streptococci showed good-preservation among these pathogenic streptococci (Fig 3B and 3C). These data suggested that the LiaR-regulated protein, PCP, mediates in vivo S. mutans biofilm and vegetation formation, and preservation of PCP implied this same role in biofilm formation of other streptococci.

LiaR regulates expression of PCP, which contributes to S. mutans biofilm formation on damaged valves in vivo.
Fig 2

LiaR regulates expression of PCP, which contributes to S. mutans biofilm formation on damaged valves in vivo.

. (A) GFP-tagged S. mutans GS5 wild type, ΔliaR, Δpcp, comΔliaR, or comΔpcp strains were intravenously injected into experimental IE rat models, and the biofilm inside vegetations harvested from injured heart valves were observed by CLSM (630× magnification). The data represent the three-dimensional structure of the S. mutans biofilm inside the rat heart valve vegetation in vivo. These experiments were repeated at least three times, with a representative experiment shown. (B) Expression of pcp in S. mutans wild type, ΔliaR and comΔliaR strains were measured by RT-PCR. The experiment was repeated three times, with a representative experiment shown. (C) The binding of LiaR on the pcp region was detected by ChIP assay. The PCR product of the 16S rRNA gene was used as a negative control. The experiment was repeated three times, with a representative experiment shown. (D and E) The role of PCP in the pathogenesis of S. mutans-induced IE was investigated using Δpcp and comΔpcp mutant strains in the experimental rat IE model. The number of colonized bacteria inside vegetations (D) and vegetation size (E) were measured. Data represent the means ± standard error of the means and were statistically analyzed using the Kruskal-Wallis test with subsequent Dunn’s test; *P < 0.05; ns, not significant. IE, infective endocarditis; GFP, green fluorescent protein; CLSM, confocal laser scanning microscopy; RT-PCR, reverse transcription-polymerase chain reaction; ChIP, chromatin immunoprecipitation; and PCR, polymerase chain reaction.

Good preservation of PCP among pathogenic streptococci.
Fig 3

Good preservation of PCP among pathogenic streptococci.

(A) The schematic illustrates upstream and downstream open reading frames and orientations of PCP among pathogenic streptococci. None of the other Psp stress operon genes were observed. (B) Alignment of the amino acid sequence of PCP among pathogenic streptococci, obtained from the NCBI database. Good preservation of the amino acid sequence was observed. (C) Homology tree of the amino acid sequences of the PCP among pathogenic streptococci.

PCP modulates bacterial eDNA release, which contributes to bacterial biofilm formation in vitro and in vivo

Our previous data showed that bacterial eDNA release, mediated by autolysin (AtlA), contributes to S. mutans biofilm formation in IE [6]. Therefore, the role of PCP in eDNA-dependent biofilm formation was further investigated. Both of liaR- and pcp-deficient mutant strains showed normal growth rates but increased chain length compared with the wild type parental strain (Fig 4A and 4B). They also showed reduced ability to release DNA to the culture supernatant and reduced the eDNA-dependent biofilm formation capacity in sucrose-free defined M4 medium (Fig 4C–4F) (6). Complementation of bacterial DNA to the culture medium restored the biofilm formation ability of the pcp-deficient strain, confirming the role of eDNA in PCP-mediated biofilm formation (Fig 4G). Moreover, we further detected eDNA inside the vegetation by staining with propidium iodide (PI) in the rat IE model [6]. The confocal laser scanning microscopy (CLSM) image results showed that eDNA was embedded inside the bacterial aggregates of S. mutans GS5 and the complementation strains (Fig 5A, yellow areas, white arrows), but liaR- or pcp-deficient mutant strains appeared as single populations or aggregates without embedded eDNA (Fig 5A, red arrows). Quantification of the fluorescence intensity of eDNA images using PI staining in yellow areas showed that eDNA was reduced inside the mutant strain biofilms compared with wild-type the complementation strains (Fig 5B). To further confirm the reduced bacterial eDNA inside the vegetation samples of mutant strains, total DNA was extracted from the harvested vegetations without lysing the bacteria, and bacterial eDNA was semi-quantified by polymerase chain reaction (PCR) with bacterial 16S ribosomal RNA (rRNA) primers [6]. Consistent with the CLSM analysis, the eDNA levels detected in the liaR- or pcp-deficient mutant strains samples were much lower than in the wild-type and complementation strains (Fig 5C and 5D). Together, these data suggest that LiaR and PCP mediate bacteria to release eDNA, which contributes to bacterial biofilm formation in the pathogenesis of IE.

PCP mediates bacterial eDNA release contributing to S. mutans biofilm formation.
Fig 4

PCP mediates bacterial eDNA release contributing to S. mutans biofilm formation.

(A) Growth curves of S. mutans GS5 wild type, ΔliaR, Δpcp, comΔliaR and comΔpcp strains were detected by measuring the absorbance at 550 nm. (B) Light microscopic views of S. mutans GS5 wild type, ΔliaR, Δpcp, comΔliaR, and comΔpcp cells. (C) eDNA released into the medium of S. mutans cultures, including wild type, ΔliaR, Δpcp, comΔliaR, and comΔpcp was PCR-amplified by bacterial 16S rRNA primers, and the products were resolved on 1% agarose gels. (D) CLSM images represent S. mutans GS5 wild type, ΔliaR, Δpcp, comΔliaR, and comΔpcp biofilms (630× magnification). S. mutans were labeled with GFP (green), and bacterial eDNA was stained with 10 μM propidium iodide. (E) The fluorescence intensity for the eDNA images of biofilm using propidium iodide staining was measured. The results show the quantified data of the extended focus images of biofilms using Image J software (National Institutes of Health). Data are expressed as the means ± standard deviations from three experiments. ***P < 0.001 by 1-way analysis of variance. ns, not significant. (F) Biofilms of S. mutans GS5 wild type, ΔliaR, Δpcp, comΔliaR, and comΔpcp were stained with 0.1% crystal violet and the absorbance quantified at 550 nm. Data are expressed as the means ± standard deviations of triplicate experiments; **P < 0.01 by 1-way analysis of variance. ns, not significant. (G) Biofilms of S. mutans GS5 wild type and ΔliaR grown with or without series concentrations of purified bacterial eDNA were stained with 0.1% crystal violet. Staining was quantified by measuring the absorbance at 550 nm. Data are expressed as the means ± standard deviations of triplicate experiments; ***P < 0.001 by 1-way analysis of variance. These. experiments were repeated three times, with a representative experiment shown. GFP, green fluorescent protein; eDNA, extracellular deoxyribonucleic acid; PI, propidium iodide; and CLSM, confocal laser scanning microscopy.

PCP mediates bacterial eDNA release contributing to S. mutans biofilm formation in vivo.
Fig 5

PCP mediates bacterial eDNA release contributing to S. mutans biofilm formation in vivo.

(A) GFP-tagged S. mutans GS5 wild type, ΔliaR, Δpcp, comΔliaR, or comΔpcp strains were intravenously injected into experimental IE rats, and the biofilm inside the vegetations harvested from injured heart valves were observed by CLSM (630× magnification). The data represent the CLSM images of biofilm formation inside the vegetation. S. mutans were labeled with GFP (green), and bacterial eDNA was stained with 10 μM propidium iodide. Yellow areas represent the presence of both S. mutans and eDNA (white arrows) and red arrows indicate single populations or aggregates without embedded eDNA. These experiments were replicated at least three times, with a representative experiment shown. (B) The fluorescence intensity of eDNA images using propidium iodide staining in the yellow aera was measured. The results show the quantified data of the extended focus images of biofilms using Image J software (National Institutes of Health). Scatter plots show values from individual rats, and each rat represents an independent experiment. Data are expressed as the means ± standard deviations. ***P < 0.001 by 1-way analysis of variance. (C and D) Total DNA isolated from vegetation (without lysing bacteria) was PCR-amplified with bacterial 16S rRNA primers and products were resolved on 1% agarose gels (C) and quantified with Image J software (National Institutes of Health) (D). Scatter plots show values from individual rats, and each rat represents an independent experiment. Data are expressed as the means ± standard deviations; ***P < 0.001 by 1-way analysis of variance. GFP, green fluorescent protein; IE, infective endocarditis; eDNA, extracellular deoxyribonucleic acid; and CLSM, confocal laser scanning microscopy; PI, propidium iodide.

The phenotype of the pcp-deficient mutant strain is quite like the atlA-deficient mutant strain, in its increased cell length and reduced ability to release eDNA to biofilm in vitro and in vivo [6]. Therefore, AtlA expression and calcium ion-induced AtlA maturation were investigated [19]. However, neither the liaR- nor the pcp-deficient strains showed reduced ability to express and process AtlA (S4 Fig). These data suggest that PCP modulates S. mutans eDNA release without affecting AtlA expression and maturation.

PCP mediates S. mutans biofilm formation via platelets in plasma in vitro and in vivo

Bacteria bind to platelets and form aggregates to enhance bacterial biofilm formation in IE [3]; therefore, the role of PCP in platelet-dependent bacterial biofilm formation was investigated further. Both liaR- and pcp-deficient mutant strains showed reduced ability to form biofilm with platelets in the plasma in vitro (Fig 6A). Consistently, they also showed reduced ability to form biofilms with platelets on damaged valves in experimental IE rat model (Fig 6B). Bacterial abilities to bind platelets and induce their aggregation mediates bacterial ability to form biofilms with platelets [3]. Interestingly, neither the liaR- nor the pcp-deficient strains showed reduced ability to induce platelet aggregation (Fig 6C) but rather had a lower ability to bind platelets when fibrinogen (Fg) was added compared with the parental strain and complementation strains (Fig 6D). The liaR- and pcp-deficient mutant strains showed a reduced ability to adhere to immobilized Fg, suggesting that the pcp-deficient strain has reduced ability to bind platelets, which is at least partly due to the reduced Fg binding ability (Fig 6E). Together, these data suggest that PCP is an essential gene for S. mutans biofilm formation in vivo as it controls eDNA release and bacterial platelet adhesion on damaged heart valves to induce IE.

PCP mediates bacterial biofilm formation with platelets in vitro and in vivo.
Fig 6

PCP mediates bacterial biofilm formation with platelets in vitro and in vivo.

(A) Biofilms of S. mutans GS5 wild type, ΔliaR, Δpcp, comΔliaR, and comΔpcp grown in PRP were observed by CLSM (magnification 630×). S. mutans were labeled with GFP (green), and platelets were stained with rhodamine-conjugated phalloidin (1:200 dilution). (B) Biofilms of S. mutans GS5 wild type, ΔliaR, Δpcp, comΔliaR, and comΔpcp inside vegetation harvested from injured heart valves were observed by CLSM (630× magnification). S. mutans were labeled with GFP (green), and platelets were stained with an anti-CD42d antibody (1:50 dilution) followed by a rhodamine-conjugated secondary antibody (1:200 dilution). (C) Platelet aggregation was measured by a Lumi-Aggregometer. Bacterial ability to induce platelet aggregation was evaluated by detecting the lag time, which indicates the time between the addition of bacterium to the PRP suspensions and onset of aggregation response. Data are expressed as the means ± standard deviations of triplicate experiments. (D) Microtiter plate wells were coated with S. mutans GS5 wild type, ΔliaR, Δpcp, comΔliaR, or comΔpcp strains then platelet suspensions with or without 100 μg/mL Fg were added. Platelet adherence was measured by acid phosphatase activity (OD405) as described in the Materials and Methods. Data are expressed as the means ± standard deviations of triplicate experiments; **P < 0.01 by 1-way analysis of variance. ns, not significant. (E) Binding capacity to immobilized Fg were compared. Microtiter plate wells were coated with Fg, and bacteria suspensions (S. mutans GS5 wild type, ΔliaR, Δpcp, comΔliaR, or comΔpcp) were added. The adhered bacteria were measured as described in the Materials and Methods. Data are expressed as the means ± standard deviations of triplicate experiments; ***P < 0.001 by 1-way analysis of variance. ns, not significant. These experiments were replicated thrice, with a representative experiment shown. PRP, platelet rich plasma; GFP, green fluorescent protein; CLSM, confocal laser scanning microscopy; IE, infective endocarditis; Fg, Fibrinogen; and PS, platelet suspension.

Discussion

Using an in vivo survival assay, the present study identified an important S. mutans response regulator, LiaR, which regulates bacterial biofilm formation on the damaged heart valve in experimental rat IE model. Distinct from other identified biofilm-regulating TCSs of S. mutans, which regulate Gtf-mediated glucan formation, LiaR regulates bacterial eDNA release and platelet adhesion in vivo. In addition to the response regulators, we also tried to identify the sensor kinases involved in pcp regulation and bacterial biofilm formation on the damaged heart valve, and we found none of the tested sensor kinases (including SMU.1128, SMU.1145, SMU.1814, SMU.1037, SMU.1009, SMU.1965, SMU.577, SMU.486 [LiaS], and SMU.1548) were found to be involved in pcp regulation and bacterial biofilm formation in vivo, including LiaS (S5 Fig). These data suggest that other sensor kinases or more than two in S. mutans are responsible for regulating PCP expression and biofilm formation in IE. Consistent with the present results, Chong et al. also reported different roles for LiaS and LiaR in the regulation of S. mutans virulence factor expression, such as gbpC expression and mutacin IV production [20]. Therefore, the sensor kinase responsible for regulating PCP expression and biofilm formation on heart valves in IE needs further examination.

In addition to LiaR, the current in vivo survival assay results also revealed the SMU.1146-deficient strain had reduced ability to colonize damaged heart valves in vivo, compared with other mutant strains (Fig 1B). Our preliminary data showed SMU.1146 deficiency did not significantly reduce the ability to induce vegetation formation in vivo, but the role of SMU.1146 in the pathogenesis of IE require further investigation. While the roles of other S. mutans response regulators [SMU.1517 (VicR), SMU.1129 (CiaR), SMU.1917 (ComE), and GcrR (CovR)] in the pathogenesis of IE were not investigated here, previous studies have demonstrated their important roles in the regulation of bacterial virulence gene expression in oral streptococci, including S. mutans [21]. Previously, we demonstrated the role of VicK in regulation of AtlA maturation, which plays important role in bacterial eDNA-dependent biofilm formation in IE [6]. However, because VicR is essential for bacterial viability, vicR-deficient strains could not be generated to investigate the role of VicR in AtlA maturation and S. mutans biofilm formation in IE. Therefore, the roles of VicR, GcrR, CiaR, and ComE in the pathogenesis of IE needs further investigation.

In addition to regulate S. mutans biofilm formation on damaged valves, LiaR has also been shown to play a role in the formation of biofilm under oxidative stress, development of genetic competence, and resistance to acidic pH [12,22]. It has also been reported to regulate expression of numerous genes, including pcp (SMU.753) [23]. However, no study has yet characterized the function of PCP in the modulation of S. mutans virulence in bacterial pathogenesis. PCP is a small protein composed of only 99 amino acids that contains a domain of PspC which is a member of the Psp stress response system [24]. The main function of the Psp system is to protect bacteria from several extreme stresses, which has been well-characterized in Gram-negative bacteria, including E. coli and Y. enterocolitica [25]. The Psp system in Gram-negative bacteria contains four core components: PspF, -A, -B, and -C [24,26]. PspA forms a complex with PspF to inhibit its activity and can also interact with the PspB-PspC complex in the inner membrane, where it may assist bacterial stress relief and maintains the proton motive force [27,28]. PspB and PspC form an integral inner membrane complex involved in activation of the Psp response and prevents toxicity of mislocalized secretins in Y. enterocolitica strains [29,30]. Most review manuscripts indicate the crucial role of PspA in the Psp stress response system [24,31]. However, pspC-null, but not pspA-null, strain of Y. enterocolitica shows severely attenuated virulence in a mouse infection model [32], suggesting the independent role of PspC in bacterial virulence modulation. In addition, PspA homologs are only found in some Gram-positive bacteria, including Bacillus subtilis [33] and Mycobacterium tuberculosis [34], but PCP can be found in most streptococci (https://www.ncbi.nlm.nih.gov/gene). Although PspC has been reported to have a role in preventing the toxicity of mislocalized secretins in Y. enterocolitica strains [29,30], little is known about the actions of PspC and the function of the PspC domain. PCP is a protein family with relatively low molecular weight and lacks any other identified functional domains, suggesting it may influence bacterial eDNA release and platelet adhesion by modulating the expression or function of other bacterial surface proteins in S. mutans. Therefore, our current working hypothesis is that PspC or PCP may affect the function and/or stability of bacterial surface-located proteins or outer membrane instability in some Gram-negative bacteria. The function of PCP will be further investigated, which may also provide important information on the function of PspC in Gram-negative bacteria.

Our previous study demonstrated that bacterial eDNA contributes to S. mutans biofilm formation on damaged heart valves of endocarditis rats [6]. The same study also showed that the autolysis protein AtlA in S. mutans contributes to bacterial eDNA release to biofilm in vitro and in vivo [6]. The phenotype of the pcp-deficient strain is quite similar to that of the atlA-deficient strain in its increased chain length and reduced ability to release eDNA (Fig 4), suggesting that PCP may play a role in AtlA-mediated autolysis. However, AtlA expression and calcium ion-induced AtlA maturation remain unchanged in pcp-deficient strain compared with the wild type strain (S1 Fig). Similarly, a previous study also showed inactivation of S. mutans chaperones RopA and PrsA increased bacterial chain length but did not influence AtlA expression [35]. These data imply that PCP may modulate the function of AtlA or influence S. mutans autolysis systems. In addition to AtlA-mediated autolysis, an S. mutans eDNA release system involving protein secretion machinery-mediated vesicle formation has also been proposed [36], but its role in the pathogenesis of IE and the underlying mechanism remain unclear. Therefore, the role of PCP in protein secretion machinery-mediated eDNA release will be also further investigated. A recent study showed that eDNA crosslinks glucan to stabilize the S. mutans biofilm on dental surface [37]. However, our previous study showed that glucosyltransferase-deficient strains do not have a reduction in the ability to cause IE [16], suggesting that glucan may not play a role in S. mutans biofilm formation on damaged heart valves. Moreover, the pcp-deficient mutant strain had no defect in the expression of glucosyltransferases or in glucan-dependent biofilm formation (S6 Fig). These data further confirm that glucan does not play a major role for bacterial biofilm formation during the pathogenesis of IE.

In addition to mediating eDNA release, PCP also mediates bacterial ability to bind platelets and form biofilm with them in an Fg-dependent manner. Fg-binding proteins, such as ClfA in Staphylococcus aureus, have been identified in several IE pathogens and play important roles in bacterial binding to platelets and IE pathogenesis [38,39]. However, no Fg-binding protein was identified in S. mutans. Here, addition of Fg enhanced S. mutans binding to platelets, suggesting an unidentified Fg-binding protein plays important roles in S. mutans biofilm formation with platelets. It is posited that other S. mutans Fg-binding protein(s) will be identified by investigating the function of PCP further. In addition, our previous study showed bacterial biofilm with platelets on damaged valves recruits neutrophils and induces NET formation, which contributes to vegetation expansion. Therefore, the liaR- or pcp-deficient strains, which have a reduced ability to form biofilms with platelets on damaged valves, also show a reduced ability to induce NETs (Fig 6B), which partly contributes to the reduced vegetation formation in the IE rat models (Figs 1D and 2E).

Taken together, the present study identified an S. mutans response regulator (LiaR) and downstream gene (PCP) which play roles in S. mutans biofilm formation on damaged heart valves in the pathogenesis of IE. These data also confirm the crucial roles of bacterial eDNA release and platelet adhesion in the pathogenesis of IE. In addition, conservation of PCP among streptococci further suggest the putative role of the PCP in biofilm formation of other streptococci.

Materials and methods

Ethics statement

Human blood samples were collected from healthy volunteers, and the study was approved by the National Taiwan University Hospital Committee for Regulation of Human Specimens and Volunteers (Taipei, Taiwan; No. 201901005RINC). All human volunteers provided informed consent.

Bacterial strains and plasmids

S. mutans UA159, GS5, and isogenic deletion-mutant strains were grown and maintained in brain-heart infusion broth (Difco Laboratories Inc., Detroit, MI, USA). The insertion mutants of response transcription regulators of S. mutans UA159, including SMU.1146, SMU.927, SMU.1815, SMU.659, SMU.1038, SMU.1008, SMU.1964, SMU.576, SMU.487, and SMU.1547, were kindly provided by Dr. Li [10]. GS5 liaR-deficient (ΔliaR), pcp-deficient (Δpcp), and pcp-complemented (comΔpcp) strain construction is described below. GFP-tagged bacteria were generated by transformation with a shuttle plasmid (pPDGFPuv) containing the GFPuv sequence described in our previous study [19]. For selection of colonies after transformation, the growth medium was supplemented with erythromycin (5 μg/mL; insertion mutants of transcription regulators), kanamycin (500 μg/mL; ΔliaR, Δpcp, comΔliaR and comΔpcp), chloramphenicol (5 μg/mL; comΔliaR and comΔpcp), or spectinomycin (500 μg/mL; pPDGFPuv).

ΔliaR, Δpcp, and comΔpcp strain construction

All references to genomic loci are based on the S. mutans UA159 genome database (https://www.ncbi.nlm.nih.gov/genome/). To construct ΔliaR and Δpcp strains, these genes in S. mutans GS5 were disrupted by insertion of a promoterless kanamycin cassette using a ligation-PCR mutagenesis strategy [40]. Briefly, the promoterless kanamycin resistance gene fragment was isolated from the pALH124 plasmid by EcoRI digestion [41]. Approximately 500-bp fragments before and/or after liaR and pcp were PCR-amplified using the forward and reverse primers listed in Table 1. PCR reaction products were digested with EcoRI, ligated with the kanamycin resistance gene fragment, and transformed directly into S. mutans GS5. Correct allelic replacement in the derived isogenic mutant strains was confirmed by PCR amplification and RT-PCR analysis was performed to verify the loss of liaR and pcp expression and confirm expression of genes downstream of liaR and pcp. For construction of the comΔliaR and comΔpcp strains, gene fragments of the liaR promoter, liaR, pcp promoter, and pcp were PCR-amplified using the primers listed in Table 1. PCR products were digested with XbaI or EcoRI and cloned into the pMC340B_Cm plasmid that contained the chloramphenicol resistance gene [19]. The resulting plasmid was transformed into the ΔliaR or Δpcp strains to generate the comΔliaR or comΔpcp strains. Expression of liaR or pcp was further confirmed by RT-PCR.

S. mutans-induced IE rat model and in vivo survival assay

Approval of animal use was obtained from the National Taiwan University Institutional Animal Care and Use Committee (Taipei, Taiwan, Republic of China) prior to initiation of experiments. A modified rat model of experimental streptococcal endocarditis was performed as previously described [16]. Briefly, a polyethylene tube with a stainless-steel wire embedded inside was inserted into the left carotid artery above the clavicles and advanced toward the chest to create injury at the aortic valves. Twenty-four hours after catheter placement, rats were intravenously infected with the bacteria at 1 × 109 CFU. For in vivo survival assay, a mix of 10 insertion mutants of transcription regulators was injected (108 for each). At 24 h post-infection, the vegetation was harvested and homogenized by ultrasonication. The bacteria colonized inside the vegetation was detected by PCR using specific primers listed in Table 1. For confocal laser scanning microscopy (CLSM) analysis, GFP-tagged S. mutans GS5 wild type, ΔliaR, Δpcp, or comΔpcp strains (1 × 109 CFU) were intravenously injected into the tail veins of Wistar rats. For the detection of bacterial eDNA, the vegetation was stained with propidium iodide. For platelets, the vegetation was stained with an anti-CD42d antibody (1:50 dilution; eBioscience, San Diego, CA, USA), followed by Texas red-tagged anti-rabbit immunoglobulin G antibody (1:500 dilution; Jackson ImmunoResearch Labs, West Grove, PA, USA), and DNA was stained with Hoechst 33258 (Sigma-Aldrich, St. Louis, MO, USA). Bacterial biofilms were then observed on a confocal microscope (Leica TCS SP5). For histologic analyses and gram staining, heart tissue was fixed with 2% paraformaldehyde, embedded in paraffin, cut into 3-μm-thick slices, and stained with hematoxylin and eosin or modified gram staining [42].

Microarray analysis

The microarray analysis of GS5 wild type and ΔliaR strains was performed as previously described [19]. S. mutans oligonucleotide microarrays were provided by The Institute for Genomic Research and supported by the National Institute of Dental and Craniofacial Research (NIH, USA). RNA of the bacteria grown in the exponential phase was extracted using an RNeasy Mini Kit (Qiagen, Germantown, MD, USA) following the manufacturer’s protocol. After purification of RNA using an RNA cleanup kit (Qiagen), cDNA synthesis, Cy dye coupling, and array hybridization was performed as The Institute for Genomic Research. Briefly, cDNA synthesis was carried out with random hexamers and RT, and the mixture was incubated at 42°C for 16 h. Following completion of cDNA synthesis, RNA was hydrolyzed with NaOH and the aminoallyl-labeled cDNA samples were purified using a QIAquick purification kit (Qiagen) followed by drying in a speed vacuum. The samples were then resuspended in 1 M NaCO3 and incubated with Cy dye (resuspended as recommended by the manufacturer) for 2 h in the dark. Each Cy3-labeled experimental sample was mixed with a Cy5-labeled reference sample and the mixtures were dried using a speed vacuum. For hybridization, the samples were resuspended in hybridization buffer and heated at 90°C for 10 min. Following a quick centrifugation, the Cy dye-coupled probes were applied to microarray slides and incubated at 42°C water bath for 17 h. Slides were then washed and scanned using an Axon GenePix 4000B scanner (Axon Instruments, Foster City, CA, USA). The data were analyzed by GeneSpring software and Significance Analysis of Oral Pathogen Microarray Data [43]. Microarray analysis data were further confirmed by RT-PCR, which was performed as previously described [44]. The primers for RT-PCR are listed in Table 1.

Recombinant LiaR construction and anti-LiaR antibody preparation

Recombinant LiaR expression plasmids were constructed by cloning of relevant PCR amplification products into the BamHI site on the pQE30 vector (Qiagen) containing a sequence encoding an N-terminal in-frame 6XHis-tag. Th PCR primers for generation of LiaR are listed in Table 1. For expression, resultant LiaR expression plasmids were transformed into E. coli M15, and protein expression was induced during logarithmic growth by addition of 1 mM isopropyl-β-d-thiogalactopyranoside. After induction, the proteins were purified via nickel chelating affinity chromatography (Qiagen) as previously described [45]. The purity of the proteins was analyzed by Coomassie blue staining following sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis analysis. Antisera against LiaR were prepared as previously described [46]. Briefly, the purified rLiaR was suspended in 3 mL of phosphate-buffered saline (PBS) and emulsified in Freund’s complete adjuvant before being used to immunize rats by intracutaneous injection. Two subsequent booster injections were intravenously given at 2-week intervals using incomplete Freund’s adjuvant, and sera was collected 2 d after the last boost. The specificity of the anti-LaR rat serum was confirmed by Western blot analysis using total protein extracts from wild type S. mutans or the liaR-deficient mutant strain.

ChIP assay

ChIP assays were performed with the anti-LiaR antibody as previously described [47] with some modifications. Briefly, S. mutans GS5 were cultured to exponential phase (OD550 = 0.4), then formaldehyde at a final concentration of 1% was added directly to the culture. The cross-linking reaction mixture was incubated at room temperature for 15 min with continuous shaking. Then, the reaction was stopped by addition of glycine (to 125 mM) for 5 min at room temperature. After washing with PBS three times by centrifugation, the chilled cells were resuspended in lysis buffer [50 mM Tris-HCl (pH 8.0), 500 mM NaCl, 1 mM EDTA, 0.1% Triton X-100, 0.1% SDS, 0.1% sodium deoxycholate, and 100 mM PMSF] containing glass beads (BioSpec, Bartlesville, OK, USA). The bacterial cells were sonicated (FastPrep FP120 homogenizer, Qbiogene Inc., Montreal, QC, Canada) to fragment chromosomal DNA to a majority size range of 0.5–1.0 kb. After centrifugation, the supernatant was harvested and used as the “input” fraction for the ChIP assay. The anti-LiaR or preimmune rat serum (5 μL/mL) was added to the input fraction for immunoprecipitation. After incubation overnight at 4 oC on a rotating platform, protein A Sepharose beads (Amersham Pharmacia Biotech, Piscataway, NJ, USA) were added to the mixtures and incubated for 1 h. After washing with lysis buffer twice, the beads were sequentially washed twice by ChIP wash buffer [10 mM Tris-HCl (pH 8.0), 1 mM EDTA, 0.25 M LiCl, and 0.5% sodium deoxycholate] and twice with TE buffer [10 mM Tris-HCl (pH 8.0) and 1 mM EDTA]. The antibody-protein-DNA complexes were further eluted with elution buffer [1% SDS, TE (pH 8.0), and 10 mM dithiothreitol] for 30 min at 37 oC. After protein digestion by proteinase K (20 mg/mL; Invitrogen, Carlsbad, CA, USA), the DNA were further purified by addition of equal volumes of a phenol-chloroform-isoamyl alcohol mix (25:24:1). After vortexing, the mixture was centrifuged at 4°C for 5 min at 16,000 × g. The aqueous phase was harvested, and the DNA was further precipitated by addition of 0.1 volumes of 3 M sodium acetate and 2.5 volumes of ice-cold 100% ethanol and incubated at -80°C. After centrifugation, the precipitated sample was air dried and suspended in 30 μL of TE buffer, which was used as the “output” fraction for PCR analyses.

Semiquantification of eDNA

Bacterial eDNA was detected and purified as previously described [6]. Briefly, the biofilms adhered to the culture tubes were disrupted and suspended by violent agitation. The culture medium was harvested by centrifugation. 1 μL of supernatant was used as a template for semiquantitative PCR (25 cycles) using specific bacterial 16S rRNA primers (Table 1). M4 medium (1 μL) without seeding bacteria was used as a negative control, and medium containing S. mutans GS5 genomic DNA was used as a positive PCR control. For the detection of bacterial eDNA inside the vegetation, total DNA was extracted without lysing bacteria using the Gentra Puregene Kit (Qiagen) following the manufacturer’s protocol. The DNA pellet was hydrated in 100 μL DNA hydration solution, and 1 μL was used as a template for semiquantitative PCR (35 cycles) using specific bacterial 16S rRNA primers (Table 1).

Preparation of human platelets

Human blood samples were collected from healthy volunteers and added to 3.2% sodium citrate at a ratio of 9:1 by volume. Human platelet-rich plasma (PRP) was prepared by centrifugation as previously described [48]. The washed platelet suspension was also prepared according to the protocol previously described [3,48,49]. PRP was supplemented with prostaglandin E1 (0.5 μM) and heparin (6.4 IU/mL) to stabilize platelets. After centrifugation, the platelets were washed twice with Tyrode solution (136.8 mM NaCl, 2.8 mM KCl, 11.9 mM NaHCO3, 1.1 mM MgCl2, 0.33 mM NaH2PO4, 1.0 mM CaCl2, 11.2 mM glucose, and 3.5 mg/mL bovine serum albumin [BSA]) with prostaglandin E1 (0.5 μM) and heparin (6.4 IU/mL). The preparation was finally resuspended in Tyrode solution at a concentration of 3–5 × 108 platelets/mL.

Biofilm formation assay

The eDNA-dependent biofilm assay was performed as previously described using sucrose-free defined M4 medium [6]. Briefly, bacterial biofilm growth was initiated by inoculating individual wells of a 96-well polystyrene microtiter plate with approximately 107 CFU in 200 μL M4 medium. Each assay was performed in triplicate, and wells without biofilms were used as blank controls. After a 16-h incubation at 37°C, the biofilm were stained with 0.1% crystal violet and quantified by measuring the absorbance at 550 nm using a MicroELISA reader (Dynatech Corp., Alexandria, VA, USA). For CLSM analysis, GFPuv-tagged strains were transformed with pPDGFPuv, and the bacterial biofilms were cultured in a 24-well plate with a round glass coverslip in individual wells. For eDNA-dependent biofilm, the biofilms were cultured in M4 medium. For bacteria-platelet aggregate biofilm, the biofilms were grown in the PRP [3]. After a 16-h incubation, biofilms that had formed on the glass coverslip were gently washed with PBS three times and then fixed with 2% paraformadehyde for 15 min. After fixation, bacterial eDNA embedded in the eDNA-dependent biofilm was stained with 10 μM propidium iodide, and the platelets in the bacteria-platelet aggregate biofilm were stained with rhodamine-conjugated phalloidin (1:200 dilution; Invitrogen). After washing with PBS three times, the coverslips were transferred to a slide and observed by CLSM (Leica TCS SP5).

Platelet adhesion assay

The platelet adhesion assay was performed as previously described with some modifications [50]. Microtiter plate wells were coated with 100 μL of bacteria (OD550 = 1.0); fibrinogen (20 μg/mL) and BSA (1%) coated wells served as positive and negative controls, respectively. After blocking with 1% BSA at 37°C for 1 h, the plate was washed with Tyrode solution three times, 50 μL of platelet suspension (3–5 × 108 platelets/mL) with or without Fg (100 μg/mL) was added and incubated at 37°C for 30 min. Pure Fg was purchased from Sigma-Aldrich. Nonadherent platelets were removed by three washes with Tyrode solution, and bound platelets were lysed at 37°C for 2 h in acid phosphatase detection buffer [0.1 M sodium acetate (pH 5.5)], 0.1% Triton X-100, and 10 mM p-nitrophenol phosphate]. The results were quantified by measuring the absorbance at 405 nm using a MicroELISA reader.

Bacterial Fg-adherence assay

The Fg adherence assay was performed as previously described [46]. Briefly, the microtiter plates were coated with 50 μL of purified Fg (0.1 mg/mL in 0.05 M sodium carbonate buffer, pH 9.6). After washing three times with PBS-Tris buffer, plates were blocked with 1% BSA. Overnight-cultured S. mutans wild type and mutant strains were washed, resuspended in 0.5 mL of PBS, and adjusted to an absorbance of 0.9 at 550 nm. The bacterial suspension (50 μL/well) was then applied to the Fg-coated assay plates and incubated 37°C at room temperature for 2 h. Nonadherent bacteria were removed with three gentle washes of PBS. Adherent bacteria were fixed with a 15-min incubation at 60°C. After cooling to room temperature, a 1:5000 dilution of antiserum against S. mutans [51] was added, followed by incubation for 1 h at 37°C. After washing with PBS three times, a 1:10,000 dilution of horseradish peroxidase-labeled goat anti-rabbit immunoglobulin G (Sigma) was applied, followed by addition of 3,3’,5,5’-tetramethylbenzidine substrate (Clinical Science Product Inc. MA, USA). The reactions were stopped by addition of 2 N H2SO4, and the absorbance at 450 nm was measured using a MicroELISA reader.

Statistical analysis

An unpaired, 2-tailed Student’s t-test was used to analyze the statistical significance of the difference between two sets of data. Differences between more than two sets of data were assessed using 1-way analysis of variance followed by the Bonferroni multiple-comparisons test. The Kruskal-Wallis test with subsequent Dunn’s test were used to analyze nonparametrically distributed data. A P < 0.05 was considered statistically significant.

Acknowledgements

The authors thank Dr. Y. H. Li (Dental Research Institute, Faculty of Dentistry, University of Toronto, Toronto, Canada) for providing the insertion mutants of response transcription regulators of S. mutans TCS.

References

LHall-Stoodley, JWCosterton, PStoodley. Bacterial biofilms: from the natural environment to infectious diseases. Nat Rev Microbiol. 2004;2(2):95108. 10.1038/nrmicro821

PMoreillon, YAQue. Infective endocarditis. Lancet. 2004;363(9403):13949. 10.1016/S0140-6736(03)15266-X

CJJung, CYYeh, CTShun, RBHsu, HWCheng, CSLin, et al. Platelets enhance biofilm formation and resistance of endocarditis-inducing streptococci on the injured heart valve. J Infect Dis. 2012;205(7):106675. 10.1093/infdis/jis021

CJJung, CYYeh, RBHsu, CMLee, CTShun, JSChia. Endocarditis pathogen promotes vegetation formation by inducing intravascular neutrophil extracellular traps through activated platelets. Circulation. 2015;131(6):57181. 10.1161/CIRCULATIONAHA.114.011432

CCHsu, RBHsu, RLOhniwa, JWChen, CTYuan, JSChia, et al. Neutrophil extracellular traps enhance Staphylococcus aureus vegetation formation through Interaction with platelets in infective endocarditis. Thromb Haemost. 2019;119(5):786796. 10.1055/s-0039-1678665

CJJung, RBHsu, CTShun, CCHsu, JSChia. AtlA mediates extracellular DNA release, which contributes to Streptococcus mutans biofilm formation in an experimental rat model of infective endocarditis. Infection and immunity. 2017;85(9). 10.1128/IAI.00252-17

DBeier, RGross. Regulation of bacterial virulence by two-component systems. Curr Opin Microbiol. 2006;9(2):14352. 10.1016/j.mib.2006.01.005

AMStock, VLRobinson, PNGoudreau. Two-component signal transduction. Annu Rev Biochem. 2000;69:183215. 10.1146/annurev.biochem.69.1.183

TMascher, JDHelmann, GUnden. Stimulus perception in bacterial signal-transduci+ng histidine kinases. Microbiol Mol Biol Rev. 2006;70(4):91038. 10.1128/MMBR.00020-06

10 

CMLevesque, RWMair, JAPerry, PCLau, YHLi, DGCvitkovitch. Systemic inactivation and phenotypic characterization of two-component systems in expression of Streptococcus mutans virulence properties. Lett Appl Microbiol. 2007;45(4):398404. 10.1111/j.1472-765X.2007.02203.x

11 

MDSenadheera, BGuggenheim, GASpatafora, YCHuang, JChoi, DCHung, et al. A VicRK signal transduction system in Streptococcus mutans affects gtfBCD, gbpB, and ftf expression, biofilm formation, and genetic competence development. J Bacteriol. 2005;187(12):406476. 10.1128/JB.187.12.4064-4076.2005

12 

YHLi, PCLau, NTang, GSvensater, RPEllen, DGCvitkovitch. Novel two-component regulatory system involved in biofilm formation and acid resistance in Streptococcus mutans. J Bacteriol. 2002;184(22):633342. 10.1128/jb.184.22.6333-6342.2002

13 

YHLi, NTang, MBAspiras, PCLau, JHLee, RPEllen, et al. A quorum-sensing signaling system essential for genetic competence in Streptococcus mutans is involved in biofilm formation. J Bacteriol. 2002;184(10):2699708. 10.1128/jb.184.10.2699-2708.2002

14 

VIdone, SBrendtro, RGillespie, SKocaj, EPeterson, MRendi, et al. Effect of an orphan response regulator on Streptococcus mutans sucrose-dependent adherence and cariogenesis. Infect Immun. 2003;71(8):435160. 10.1128/iai.71.8.4351-4360.2003

15 

SBiswas, IBiswas. Regulation of the glucosyltransferase (gtfBC) operon by CovR in Streptococcus mutans. J Bacteriol. 2006;188(3):98898. 10.1128/JB.188.3.988-998.2006

16 

CTShun, SYLu, CYYeh, CPChiang, JSChia, JYChen. Glucosyltransferases of viridans streptococci are modulins of interleukin-6 induction in infective endocarditis. Infect Immun. 2005;73(6):326170. 10.1128/IAI.73.6.3261-3270.2005

17 

SLu, JWang, FChitsaz, MKDerbyshire, RCGeer, NRGonzales, et al. CDD/SPARCLE: the conserved domain database in 2020. Nucleic Acids Res. 2020;48(D1):D265D8. 10.1093/nar/gkz991

18 

PModel, GJovanovic, JDworkin. The Escherichia coli phage-shock-protein (psp) operon. Mol Microbiol. 1997;24(2):25561. 10.1046/j.1365-2958.1997.3481712.x

19 

CJJung, QHZheng, YHShieh, CSLin, JSChia. Streptococcus mutans autolysin AtlA is a fibronectin-binding protein and contributes to bacterial survival in the bloodstream and virulence for infective endocarditis. Mol Microbiol. 2009;74:888902. 10.1111/j.1365-2958.2009.06903.x

20 

PChong, LDrake, IBiswas. LiaS regulates virulence factor expression in Streptococcus mutans. Infect Immun. 2008;76(7):30939. 10.1128/IAI.01627-07

21 

ROMattos-Graner, MJDuncan. Two-component signal transduction systems in oral bacteria. J Oral Microbiol. 2017;9(1):1400858. 10.1080/20002297.2017.1400858

22 

JAPerry, CMLevesque, PSuntharaligam, RWMair, MBu, RTCline, et al. Involvement of Streptococcus mutans regulator RR11 in oxidative stress response during biofilm growth and in the development of genetic competence. Lett Appl Microbiol. 2008;47(5):43944. 10.1111/j.1472-765X.2008.02455.x

23 

MShankar, SSMohapatra, SBiswas, IBiswas. Gene regulation by the LiaSR two-component system in Streptococcus mutans. PLoS One. 2015;10(5):e0128083. 10.1371/journal.pone.0128083

24 

JFlores-Kim, AJDarwin. The Phage Shock Protein Response. Annu Rev Microbiol. 2016;70:83101. 10.1146/annurev-micro-102215-095359

25 

NJoly, CEngl, GJovanovic, MHuvet, TToni, XSheng, et al. Managing membrane stress: the phage shock protein (Psp) response, from molecular mechanisms to physiology. FEMS Microbiol Rev. 2010;34(5):797827. 10.1111/j.1574-6976.2010.00240.x

26 

GJovanovic, LWeiner, PModel. Identification, nucleotide sequence, and characterization of PspF, the transcriptional activator of the Escherichia coli stress-induced psp operon. J Bacteriol. 1996;178(7):193645. 10.1128/jb.178.7.1936-1945.1996

27 

MKleerebezem, WCrielaard, JTommassen. Involvement of stress protein PspA (phage shock protein A) of Escherichia coli in maintenance of the protonmotive force under stress conditions. EMBO J. 1996;15(1):16271.

28 

RKobayashi, TSuzuki, MYoshida. Escherichia coli phage-shock protein A (PspA) binds to membrane phospholipids and repairs proton leakage of the damaged membranes. Mol Microbiol. 2007;66(1):1009. 10.1111/j.1365-2958.2007.05893.x

29 

MEMaxson, AJDarwin. PspB and PspC of Yersinia enterocolitica are dual function proteins: regulators and effectors of the phage-shock-protein response. Mol Microbiol. 2006;59(5):161023. 10.1111/j.1365-2958.2006.05047.x

30 

LWeiner, JLBrissette, NRamani, PModel. Analysis of the proteins and cis-acting elements regulating the stress-induced phage shock protein operon. Nucleic Acids Res. 1995;23(11):20306. 10.1093/nar/23.11.2030

31 

RManganelli, MLGennaro. Protecting from Envelope Stress: Variations on the Phage-Shock-Protein Theme. Trends Microbiol. 2017;25(3):20516. 10.1016/j.tim.2016.10.001

32 

AJDarwin, VLMiller. The psp locus of Yersinia enterocolitica is required for virulence and for growth in vitro when the Ysc type III secretion system is produced. Mol Microbiol. 2001;39(2):42944. 10.1046/j.1365-2958.2001.02235.x

33 

TMascher, SLZimmer, TASmith, JDHelmann. Antibiotic-inducible promoter regulated by the cell envelope stress-sensing two-component system LiaRS of Bacillus subtilis. Antimicrob Agents Chemother. 2004;48(8):288896. 10.1128/AAC.48.8.2888-2896.2004

34 

PDatta, JRavi, VGuerrini, RChauhan, MBNeiditch, SSShell, et al. The Psp system of Mycobacterium tuberculosis integrates envelope stress-sensing and envelope-preserving functions. Mol Microbiol. 2015;97(3):40822. 10.1111/mmi.13037

35 

PJCrowley, LJBrady. Evaluation of the effects of Streptococcus mutans chaperones and protein secretion machinery components on cell surface protein biogenesis, competence, and mutacin production. Mol Oral Microbiol. 2016;31(1):5977. 10.1111/omi.12130

36 

SLiao, MIKlein, KPHeim, YFan, JPBitoun, SJAhn, et al. Streptococcus mutans extracellular DNA is upregulated during growth in biofilms, actively released via membrane vesicles, and influenced by components of the protein secretion machinery. J Bacteriol. 2014;196(13):235566. 10.1128/JB.01493-14

37 

KRainey, SMMichalek, ZTWen, HWu. Glycosyltransferase-mediated biofilm matrix dynamics and virulence of Streptococcus mutans. Appl Environ Microbiol. 2019;85(5). 10.1128/AEM.02247-18

38 

PMoreillon, JMEntenza, PFrancioli, DMcDevitt, TJFoster, PFrancois, et al. Role of Staphylococcus aureus coagulase and clumping factor in pathogenesis of experimental endocarditis. Infect Immun. 1995;63(12):473843. 10.1128/IAI.63.12.4738-4743.1995

39 

DMcDevitt, PFrancois, PVaudaux, TJFoster. Identification of the ligand-binding domain of the surface-located fibrinogen receptor (clumping factor) of Staphylococcus aureus. Mol Microbiol. 1995;16(5):895907. 10.1111/j.1365-2958.1995.tb02316.x

40 

PCLau, CKSung, JHLee, DAMorrison, DGCvitkovitch. PCR ligation mutagenesis in transformable streptococci: application and efficiency. J Microbiol Methods. 2002;49(2):193205. 10.1016/s0167-7012(01)00369-4

41 

BHKremer, Mvan der Kraan, PJCrowley, IRHamilton, LJBrady, ASBleiweis. Characterization of the sat operon in Streptococcus mutans: evidence for a role of Ffh in acid tolerance. J Bacteriol. 2001;183(8):254352. 10.1128/JB.183.8.2543-2552.2001

42 

SCBecerra, DCRoy, CJSanchez, RJChristy, DMBurmeister. An optimized staining technique for the detection of Gram positive and Gram negative bacteria within tissue. BMC Res Notes. 2016;9:216. 10.1186/s13104-016-1902-0

43 

TChen, KAbbey, WJDeng, MCCheng. The bioinformatics resource for oral pathogens. Nucleic Acids Res. 2005;33(Web Server issue):W73440. 10.1093/nar/gki361

44 

JSChia, YYLee, PTHuang, JYChen. Identification of stress-responsive genes in Streptococcus mutans by differential display reverse transcription-PCR. Infect Immun. 2001;69(4):2493501. 10.1128/IAI.69.4.2493-2501.2001

45 

CYYeh, JYChen, JSChia. Glucosyltransferases of viridans group streptococci modulate interleukin-6 and adhesion molecule expression in endothelial cells and augment monocytic cell adherence. Infect Immun. 2006;74(2):127383. 10.1128/IAI.74.2.1273-1283.2006

46 

JSChia, CYYeh, JYChen. Identification of a fibronectin binding protein from Streptococcus mutans. Infect Immun. 2000;68(4):186470. 10.1128/iai.68.4.1864-1870.2000

47 

KNishikawa, FYoshimura, MJDuncan. A regulation cascade controls expression of Porphyromonas gingivalis fimbriae via the FimR response regulator. Mol Microbiol. 2004;54(2):54660. 10.1111/j.1365-2958.2004.04291.x

48 

JSChia, YLLin, HTLien, JYChen. Platelet aggregation induced by serotype polysaccharides from Streptococcus mutans. Infect Immun. 2004;72(5):260517. 10.1128/iai.72.5.2605-2617.2004

49 

JFMustard, DWPerry, NGArdlie, MAPackham. Preparation of suspensions of washed platelets from humans. Br J Haematol. 1972;22(2):193204. 10.1111/j.1365-2141.1972.tb08800.x

50 

NSJakubovics, SWKerrigan, AHNobbs, NStromberg, CJvan Dolleweerd, DMCox, et al. Functions of cell surface-anchored antigen I/II family and Hsa polypeptides in interactions of Streptococcus gordonii with host receptors. Infect Immun. 2005;73(10):662938. 10.1128/IAI.73.10.6629-6638.2005

51 

JSChia, TYHsu, LJTeng, JYChen, LJHahn, CSYang. Glucosyltransferase gene polymorphism among Streptococcus mutans strains. Infect Immun. 1991;59(5):165660. 10.1128/IAI.59.5.1656-1660.1991