Bacterial strains

Two clinical MRSA strains (KAM17 and KAM18; Table 1) were used in this study, both of which were isolated from the same patient, who was admitted to a hospital in Japan and treated with VAN followed by DAP. KAM17 was isolated before, and KAM18 was isolated after DAP administration. Antibiotic susceptibility testing, performed by the hospital, determined that KAM17 was susceptible to DAP, while KAM18 was non-susceptible.

Table 1

Bacterial strains and plasmids used in this study.

Strains/Plasmids	Description	Source or Reference
Strains
KAM17	DAP-susceptible MRSA	Clinical isolate
KAM18	DAP-non-susceptible MRSA	Clinical isolate
KAM17mut	KAM17 transduced with MprF T345I	This study
KAM17mutR	Reverse mutant from KAM17mut	This study
Plasmids
pMD20-T	Cloning vector for TA-cloning	TaKaRa bio Inc.
pIMAY	Shuttle vector for gene replacement in Gram-positive bacteria	[21]
pIMAY-mprF-WT	pIMAY vector containing wild-type mprF gene	This study
pIMAY-mprF-T345I	pIMAY vector containing mutant mprF gene (T345I)	This study

Genotyping of isolated strains with POT method

The genotyping of each strain was performed by the PCR-based ORF Typing (POT) method, which is a molecular epidemiological method capable of identifying and distinguishing isolates at the strain-level [22]. We identified these strains with the Cica Geneus® Staph POT KIT (Kanto Chemical, Japan) according to the manufacturer's manual.

Sequencing analysis of mprF

Genomic DNA was isolated from each MRSA strain as follows. Bacteria were cultured on trypticase soy agar at 37°C overnight. Bacterial colonies were then scraped from the agar plate, resuspended in 100 μL of lysis buffer (20 μg/mL lysostaphin, 1000 U/mL achromopeptidase in TE buffer), and incubated for 10 min at 37°C. Next, 50 μL of 0.5M KOH and 50 μL of 1M Tris/HCl were added for alkaline treatment and neutralization, respectively. The obtained solution contained DNA, which was used in subsequent experiments. Using 2 μL of the DNA aliquot as a template, PCR amplification of mprF was performed by TaKaRa Taq HS Perfect Mix (Takara Bio, Japan) with the primers listed in Table 2. PCR clean-up was performed by ExoSAP-IT (Thermo Fisher Scientific, MA, USA), and the final product was used as a sequencing template. Sequence analysis was performed by Eurofins Genomics (Tokyo, Japan) with the primers listed in Table 2. The sequencing data were analyzed using ApE software (created and maintained by Wayne Davis from the University of Utah) and aligned with the reference sequence of mprF of Staphylococcus aureus N315 (GenBank accession number NC_002745.2).

Table 2

Primers for sequencing and cloning of mprF gene.

Primers	Sequence (5’-3’)
mprF PCR Primers
mprF-F1	GCACTCATAATCGGCTGTT
mprF-R1	TTGGGCTGATAATAAAAGTT
mprF Sequence Primers
mprF-F2	ACCATATTGTTCTGTTTGAG
mprF-F3	TATTGGTGCAGGCGTTAGAG
mprF-F4	GGCGCTTTCGATTTAGTTGT
mprF-F5	AGCTATTATTTTTGTTCTGC
mprF-F6	TTTAACGCAATTTTCAACTT
mprF-R2	TAAATCTAACTCTGGCAACC
mprF-R3	TCCAAGAACCACTAATGAAC
mprF-R4	GATAATGGCACGTCTACTTT
mprF-R5	AGCGTCAACAATTACACCAC
mprF-R6	CCACCAATAAATAGTAACAC
mprF Cloning Primers
ClaI-mprF-F0	AAAAAATCGATATGAATCAGGAAGTTAAAAACAAAA
NotI-mprF-R0	AAAAAGCGGCCGCTTATTTGTGACGTATTACACGCATT
pIMAY-F	TACATGTCAAGAATAAACTGCCAAAG
pIMAY-R	AATACCTGTGACGGAAGATCACTTCG

Genetic exchange of mutant mprF with pIMAY vector

Plasmids used for genetic exchange in this study are shown in Table 1. The wild-type mprF gene (mprF-WT) in KAM17 and the mutant mprF gene (mprF-T345I) in KAM18 were cloned in a pIMAY vector as follows: mprF from each strain was amplified by PCR using Mighty TA-cloning Kit (Takara). The restriction enzyme sites for ClaI and NotI were attached to the PCR primers (Table 2). The PCR products were cloned into the pMD20-T vector by TA-cloning. The mprF gene cloned in pMD20-T was spliced out by digestion with ClaI and NotI, transferred into the MCS of pIMAY vector, and designated as pIMAY-mprF-WT and pIMAY-mprF-T345I (Table 1).

pIMAY (a kind gift from Dr. Foster of Trinity College, Dublin) is a shuttle vector for the genetic exchange of Staphylococcus. The plasmid contains temperature-sensitive gram-positive replication genes and a tetracycline-inducible antisense secY region, which enables exchange of arbitrary genes in Staphylococcus [21]. For genetic exchange from wild-type mprF to mutant mprF in KAM17, electrocompetent KAM17 cells were prepared according to the instructions provided for Gene Pulser Xcell™ (Bio-Rad).

The pIMAY-mprF-T345I construct was transformed into KAM17 competent cells by electroporation using Gene Pulser Xcell™ Electroporation System (Bio-Rad) according to the manufacturer's instructions. KAM17 harboring the plasmid were selected following incubation on trypticase soy agar containing 10 μg/mL chloramphenicol at 28° C for 48 h. After selection, KAM17 cells containing pIMAY-mprF-T345I were incubated overnight at 39°C for allelic exchange between genomic mprF (wild-type in KAM17) and plasmid mprF (mutant in pIMAY). Following recombination, plasmid excision was done as follows: For pre-incubation, KAM17 containing pIMAY-mprF-T345I was incubated overnight in trypticase soy broth at 28°C under shaking conditions. The broth was then diluted ten-fold and plated onto trypticase soy agar containing 1 μg/mL anhydrotetracycline. Plates were incubated at 28°C for 48 h for plasmid excision. To confirm plasmid excision, the developed colonies were streaked onto trypticase soy agar plates containing 10μg/mL chloramphenicol at 28°C for 48 h. A chloramphenicol susceptible clone was considered as a plasmid excised clone and designated as KAM17mut, which contained the mutant mprF gene. To construct a reverse mutant of KAM17mut, the pIMAY-mprF-WT plasmid was transferred into KAM17mut, as described above. The acquired reverse mutant was designated as KAM17mutR, which contained the wild-type mprF gene.

Antibiotics susceptibility test

E-test determined the MIC of anti-MRSA agents against each strain. Overnight culture of each strain on trypticase soy agar was suspended in normal saline and adjusted to an OD₅₉₀ of 0.30. We then collected 100 μL of the suspension and plated it on Mueller-Hinton E agar (Sysmex bioMérieux, France) using a sterilized swab. Then E-test strips of DAP, VAN, TEC, LZD, and oxacillin (OXA) (Sysmex bioMérieux) were placed on the agar. After 24-h- incubation at 37°C, the MIC of each antimicrobial agent was measured, which was performed three times, and the median value of the three experiments was defined as the MIC of the antibiotic against the strain.

Population analysis for daptomycin

Population analysis of each strain was performed according to a previously described method [23]. This analysis shows the drug resistant level of a strain subpopulation. Strains were cultured overnight in trypticase soy broth, and subsequently diluted to an OD₅₉₀ of 0.30. This dilution was serially diluted by ten-fold, and 100 μL of each dilution was spread on Mueller-Hinton agar (Becton Dickinson, NJ, USA) containing various concentrations of DAP (0 μg/mL to 5 μg/mL). Calcium concentration in the agar was adjusted to 50 μg/mL. Plates were incubated for 48 h at 37°C, and the colonies were counted. The experiment was performed twice.

Cytochrome c binding assay

Bacteria were cultured on trypticase soy agar for 18 h at 37°C, then washed with 20 mM MOPS buffer twice. The bacterial cells were harvested by centrifugation at 19,000 × g for 2 min, and the pellet was resuspended in 20 mM MOPS buffer. Bacterial density was adjusted to an OD₅₉₀ of 7.0 in the MOPS buffer. An aliquot of 200 μL of this suspension was then transferred into a new 2 mL tube. Cytochrome c (Sigma) solution (2.5 mg/mL in MOPS buffer) was added to the bacterial suspension (final concentration 0.5 mg/mL) and incubated for 10 min at room temperature. The solution was centrifuged for 2 min at 19,000 × g, and the supernatant was harvested and filtrated with a 0.2 μm pore size filter (Minisart RC4, Sartorius, Germany). The filtrate was assayed photometrically at 530 nm with Gene Quant 100 (GE Healthcare, IL, USA). Six independent runs were performed.

Growth curve and doubling time

Overnight culture of each strain in trypticase soy broth was diluted 1000 times in fresh trypticase soy broth. The diluted broth was incubated at 37°C with shaking for 48 h, and OD₆₆₀ of the broth was measured at an interval of 2 min by absorptiometer (TVS062CA: Advantec, Tokyo, Japan). Doubling time during the exponential growth phase was calculated by the regression line of the growth curve. Three independent runs were performed on separate days.

Transmission electron microscopy

Cell wall thickness was evaluated by transmission electron microscopy as described previously [24–26]. Bacteria were cultured in trypticase soy broth for 18 h at 37°C, then diluted 100 times by fresh trypticase soy broth and cultured for 6 h at 37°C to a logarithmic growth phase. The cells were harvested and washed twice with phosphate-buffered saline, then fixed in 2% glutaraldehyde in 0.1 M phosphate-buffered saline for 2 h at room temperature, and in 1% osmium tetroxide in the same buffer for 1 h on ice. Fixed cells were then dehydrated in a graded series of ethanol and propylene oxide, and subsequently embedded in EPON812 (TAAB, UK). Ultra-thin sections were cut and stained with uranyl acetate and lead citrate, and photographic images were obtained at a final magnification of 20,000× with a transmission electron microscope (H7500, Hitachi High-Technologies, Japan) equipped with a digital camera system. The thicknesses of the cell wall with nearly equatorially cut surfaces were measured. The thicknesses of each cell was calculated as follows: a transparent grid made up of 20 radial lines arranged regularly at angles of 18° was placed on the center of each cell. The interaction zones between the grid line and the cell wall were then measured at ten different points, the mean of which was considered to designate the cell thicknesses. Fifty cells in each strain were measured; the results were expressed as mean ± SDs.

Statistical analysis

Statistical analysis was performed using KaleidaGraph (Synergy Software, PA, USA). ANOVA with Tukey-Kramer post-test was used to compare results between more than two groups.

POT typing of each strain

The genotyping of each strain was carried out by the POT method (Fig 1). Each strain showed the same band pattern, and the POT type was 92-244-113, indicating MRSA SCCmec type II. This result showed that the two clinical isolates were derived from the same origin.

Fig 1

POT analysis for genotyping of each strain.

Clinical isolates KAM17 and KAM18 had the same POT pattern. Manipulated strains KAM17mut and KAM17mutR also had the same POT pattern as KAM17. The band of 355 bp in mixture 1 was SCCmec type II specific.

Point mutation of mprF in DAP-NS strain

The sequence analysis of mprF in each strain is shown in Fig 2. The 1034th cytosine was replaced with thymine in KAM18, a DAP-NS MRSA strain (Staphylococcus aureus N315 was taken as the reference strain). This SNP resulted in a missense mutation in mprF, which led to T345I amino acid substitution in MprF. DAP-S MRSA strain KAM17 had no mutation in the mprF gene.

Fig 2

Sequence analysis of the mprF gene in each strain.

The 1034th cytosine was changed to thymine in KAM18 causing a missense mutation, which resulted in T345I amino acid substitution. N315 was used as a reference sequence of mprF.

Correlation of DAP susceptibility with mprF mutation

Antibiotics susceptibility of each strain is shown in Table 3. KAM17 isolated before administration of DAP was susceptible to DAP (MIC ≤ 1 μg/mL); KAM18 isolated after administration of DAP was non-susceptible to DAP (MIC > 1μg/mL). The constructed mutant MprF (T345I) strain KAM17mut showed non-susceptibility to DAP, while the reverse mutant strain KAM17mutR was susceptible to DAP. In mprF mutant strains, MICs of VAN and TEC were elevated, whereas MIC for LZD was reduced. The MICs of OXA were >256 μg/mL in all strains.

Table 3

MICs of each strain by E-test.

Bacterial strains	MIC of Antibiotics (μg/mL)
	DAP	VAN	TEC	LZD	OXA
KAM17	0.5	1.5	1.5	1.5	>256
KAM18	3	3	2	1.0	>256
KAM17mut	3	3	2	1.0	>256
KAM17mutR	0.5	1.5	1.5	1.5	>256

Each value represents the median of three measurements.

DAP: daptomycin, VAN: vancomycin, TEC: teicoplanin, LZD: linezolid, OXA: oxacillin

Population analysis in the presence of DAP

To investigate the susceptibility of the mutant strain KAM17mut to DAP, population analysis of the strain in the presence of DAP was carried out. KAM17mut exhibited a DAP non-susceptible pattern similar to that of KAM18. Meanwhile, the parent strain KAM17 and reverse mutant strain KAM17mutR both exhibited a DAP susceptible pattern (Fig 3).

Fig 3

Population analysis of each strain for DAP susceptibility.

The number of colonies developed on the plates containing various concentrations of DAP was counted. The data shown are representative of two independent experiments with similar results.

Cell surface positive charge

Cytochrome c binding assay was carried out to measure the cell surface positive charge. After cytochrome c bound to the cell, the adsorbed abundance was calculated. Cytochrome c has a positive charge; thus, a more positively charged cell indicates the presence of more cytochrome c in the supernatant. Compared with KAM17 and KAMmutR, cytochrome c adsorption was significantly decreased in the mprF mutant strain KAM17mut to the same level as that observed for the DAP-NS strain of KAM18 (Fig 4). This result demonstrated that the surface of the mprF mutant strain had a higher positive charge than that of the wild-type strain.

Fig 4

Cytochrome c binding assay of each strain.

Each strain was incubated with cytochrome c. The adsorbed cytochrome c was calculated by the residual cytochrome c in the supernatant. The error bars indicate standard error from six independent experiments (** p < 0.01).

Growth curve and doubling time

To investigate whether mprF mutation affects cell growth speed, each strain was cultured in trypticase soy broth, and optical density was measured intermittently. The mprF mutant strain KAM17mut grew slower than the mprF wild-type strain KAM17 and KAM17mutR. Specifically, the doubling time of KAM17mut was 36.2 min, while that of KAM17 and KAMmutR was 27.8 min. The clinically isolated DAP-NS strain KAM18 also grew slower than DAP-S strains (Fig 5). These results indicate that the mprF mutation affected cell growth speed.

Fig 5

Growth curve of each strain.

(A) The concentration of bacteria was measured as the optical density at 660 nm. MprF mutant DAP resistant strain KAM18 and KAM17mut grew slower than DAP susceptible strains, KAM17 and KAM17mutR. The growth curves are representative of three independent experiments with similar results. (B) The doubling time of each strain was calculated according to its regression curve. The calculated values represent mean ± SD of three independent experiments (**p<0.01 vs. KAM17).

Cell wall thickness

Considering that a thicker cell wall is a feature associated with DAP-NS strain [26], we also investigated the cell wall thickness of each strain by transmission electron microscopy. Results show that the cell wall in the DAP-NS strains KAM18 and KAM17mut were thicker than that of DAP-S strains KAM17 and KAM17mutR (Fig 6).

Fig 6

Transmission electron microscopy images of each strain.

(A) Cell wall thickness was measured at 200,000× magnification. Fifty measurements were obtained, and the results are expressed as mean ± SDs (**p<0.01 vs. KAM17).