PLoS ONE

Home In vivo effects of olive oil and trans-fatty acids on miR-134, miR-132, miR-124-1, miR-9-3 and mTORC1 gene expression in a DMBA-treated mouse model
In vivo effects of olive oil and trans-fatty acids on miR-134, miR-132, miR-124-1, miR-9-3 and mTORC1 gene expression in a DMBA-treated mouse model
In vivo effects of olive oil and trans-fatty acids on miR-134, miR-132, miR-124-1, miR-9-3 and mTORC1 gene expression in a DMBA-treated mouse model

Competing Interests: The authors have declared that no competing interests exist.

Article Type: Research Article Article History
  • Altmetric
Abstract

Both the intake of beneficial olive oil and of harmful trans-fatty acids (TFAs) in consumed foods are of great significance in tumor biology. In our present study we examined the effects they exert on the expression patterns of miR-134, miR-132, miR-124-1, miR-9-3 and mTOR in the liver, spleen and kidney of mice treated with 7,12-dimethylbenz [a] anthracene (DMBA). Feeding of TFA-containing diet significantly increased the expression of all studied miRs and mTORC1 in all organs examined, except the expression of mTORC1 in the spleen and kidney. Diet containing olive oil significantly reduced the expression of miR-124-1, miR-9-3 and mTORC1 in the liver and spleen. In the kidney, apart from the mTORC1 gene, the expression of all miRs examined significantly decreased compared to the DMBA control. According to our results, the cell membrane protective, antioxidant, and anti-inflammatory effects of olive oil and the cell membrane damaging, inflammatory, and carcinogenic properties of TFA suggest negative feedback regulatory mechanisms. In contrast to our expectations, mTORC1 gene expression in the kidney has not been shown to be an appropriate biomarker–presumably, because the many complex effects that regulate mTOR expression may quench each other.

Molnar,Szabo,Tomesz,Deutsch,Darago,Ghodratollah,Varjas,Nemeth,Budan,Kiss,and Máthé: In vivo effects of olive oil and trans-fatty acids on miR-134, miR-132, miR-124-1, miR-9-3 and mTORC1 gene expression in a DMBA-treated mouse model

Introduction

Malignant tumorous diseases are the second leading causes of deaths worldwide; according to the estimates of WHO they caused 9.6 million deaths in 2018. The main causes of the development of these diseases are the adverse environmental effects [1], within which eating habits represent a major factor [2]. Such a factor, for example, is the intake of fatty acids (FAs) including harmful trans-fatty acids (TFAs) [3, 4]. On the other hand, olive oil, which has beneficial effects and is rich in antioxidant and antitumor oleic acid and contains approximately 10% linoleic acid, is also widely consumed [5, 6].

The amount of daily TFA intake shows positive correlation with mortality when comparing the data of the upper (≥ 2.73 calorie percent) and lower quartiles (≤1.41 caloric percent) on the basis of the hazard ratio (HR) normalized to gender and age (HR: 1.03; CI 1.00–1.05; p trend = 0.0062) [4]. Although TFA intake does not correlate with overall cancer mortality, there is a positive correlation between the regular daily intake of TFA and relative risk (RR) of breast cancer in postmenopausal women (RR: 1.37; 95% CI 1.04–1.81; p = 0.02) [4, 7]. The adverse effects of TFA are also shown by the fact that a 2% increase in dietary caloric intake significantly increased the risk of cardiovascular diseases (RR 1.23; 95% CI 1.11–1.37; p <0.001) [8].

Indeed, there are direct and indirect harmful molecular mechanisms associated with TFA consumption. For example, trans-linoleic acid (trans, trans-9-12-octadecadienoic acid) (TLA) and elaidic acid (trans-9-octadecenoic acid) (EA), which belong to TFAs, increase the amount of intercellular adhesion molecule-1 (ICAM-1) and vascular cell adhesion molecule-1 (VCAM-1), among other [9]. Both ICAM-1 and VCAM-1 generate reactive oxygen species (ROS), which activate nuclear factor kappa B (NF-κB)–which has direct pro-inflammatory effect [9]. Its further significance is, that in addition to inflammatory signaling pathways, NF-κB activation may be associated with malignant transformation processes, as well [10].

When studying the protective effects of olive oil Pelucchi et al. have performed a meta-analysis on the relationship between olive oil and cancer, where the calculated summary relative risk of breast cancer was 0.62 (95% CI 0.44–0.88) for the highest versus the lowest level of olive oil consumption [3]. Furthermore, in a case-control study, olive oil consumption significantly reduced the risk of development of lung cancer (OR: 0.65; 95% CI: 0.42–0.99; p <0.05) [11]. In another case-control study performed by Bosetti et al., a significant trend in the protective effect against laryngeal cancer was observed between the upper quartile consuming 42.9 grams of olive oil per day and the lower quartile consuming less than 3.2 grams per day (OR: 0.4; 95% CI: 0.3–0.7; p = 0.01) [2]. In another case-control study when comparing the lowest versus the middle tertile consuming less than 1.6 grams of olive oil per day (OR: 0.62; 95% CI: 0.39–0.99), and the highest versus the lowest tertile consuming above 3.9 grams per day (OR: 0.47; 95% CI: 0.28–0.78; p-trend = 0.002), a statistically significant inverse dose-response association was found between development of bladder cancer and the olive oil consumption [12].

MicroRNAs (miRNA) bind to the 3 ’UTR of mRNAs and thus reduce the translation of mRNAs–and thereby through gene silencing affect the protein synthesis, the cell cycle [13], apoptosis, or even cell differentiation [14]. MiRNAs may serve as early molecular epidemiological biomarkers for the detection of malignancies [15]. In addition, TFA also causes oxidative stress and lipid peroxidation [16], which may be associated with the expression pattern of certain miRNAs (e.g., miR-134), as miR-134 is involved in tumor cell proliferation, apoptosis, invasion, and also in the regulation of metastasis formation [17]. Furthermore, miR-134 is known as a tumor suppressor because it directly silences the KRAS oncogene as well as the integrin beta 1 (ITGB1) oncogene [18, 19], the activity of which genes also promotes malignant transformation and proliferation of malignant cells [20], which can lead to renal cell carcinoma (RCC) [21]. MiR-132 also inhibits proliferation in hepatocellular carcinoma (HCC) by inactivating the AKT / mTOR signaling pathway [22], and by inhibiting IL1β and IL6 expression through inhibition of the transcriptional co-activator P300 [23]. Overexpression of miR-124 was observed in HCC for the regulation of proliferation of the anti-apoptotic “baculoviral IAP repeat containing 3 (BIRC3) protein”, as well as for the inhibition of NF-κB signaling pathway and C-MYC oncogene expression [24]. (For general expressions of examined miRs and mTOR see Table 1, for the list of abbreviations Table 2).

Table 1
General expressions of examined miRs and mTOR.
miR-134miR-132miR-124miR-9mTORLiterature
DMBA+++++
TFA+++++
Olive oil-----
HCC--- or +[19, 24]
RCC-++[19, 46]
Table 2
List of abbreviations.
AbbreviationName of expression
ATMataxia-telangiectasia mutated
BIRC3baculoviral IAP repeat containing 3
DMBA7,12-dimethylbenz [a] anthracene
EAelaidic acid
FAfatty acid
GSHgluthation
HCChepatocellular carcinoma
HIF-1αHypoxia-inducible factor 1-alpha
HRhazard ratio
ICAM-1intercellular adhesion molecule-1
IL1βinterleukin 1β
IL6interleukin 6
ITGB1integrin beta 1
miRNAmicroRNA
MMPmatrix metalloproteinase
mTORmammalian target of rapamycin
NF-κBnuclear factor kappa B
PTENphosphatase and tensin homolog deleted on chromosome 10
PUFApoly unsaturated fatty acids
RCCrenal cell carcinoma
ROSreactive oxygen species
RRrelative risk
TFAtrans-fatty acid
TGF-βtransforming growth factor-β
TLAtrans-linoleic acid
TNFtumor necrosis factor
TSC2tuberous sclerosis complex 2
VCAM-1vascular cell adhesion molecule-1

Thus, miR-9, miR-124, miR-132, and miR-134 exert their antitumor activity indirectly, through the inhibition of NF-κB and AKT/mTOR signaling pathways [19, 22, 24, 25]. The mammalian target of rapamycin (mTOR) signaling protein plays a vital role in cellular functions such as cell proliferation, cell growth, protein synthesis, and its expression is influenced by a number of factors (see above). Thus, the question arises whether in addition to the miRs studied, the expression of mTOR can be used as a biomarker of carcinogenic and chemopreventive effects, or not.

In our present study we modelled two types of human dietary habits in mice, namely, high olive oil consumption and high TFA intake. For this purpose, we used a model developed by Tomesz et al., and we examined the expression of miR-134, miR-132, miR-124-1, miR-9-3, and of mTOR in the liver, spleen and kidney of 7,12-dimethylbenz [a] anthracene (DMBA) treated mice as molecular epidemiological biomarkers [26]. The effect of DMBA damage is indicated by an increase both in the expression of these miRs and in the expression of mTOR, among other, in the examined organs, since DMBA is a pluripotent carcinogen, while induces mutations and increases the expression of oncogenes, etc. [26]. The aim of our research was to explore the expression patterns of these miRs so that we can follow the harmful and beneficial tumor biological effects of TFA and olive oil.

Materials and methods

In the experiment we used 6 to 8 weeks old CBA/Ca female mice, each group caged separated. For 14 days one group of animals (n = 6) was fed with olive oil in a dose of 0.3 g/animal/day (Agraria Riva Del Garda SCA) and another group (n = 6) received TFA (trans-3-hexadecenoic acid) (Sigma Aldrich) in a daily dose of 0.3 g/animal, mixed into their diet. The animals were treated once with DMBA 20 mg/kg body weight intraperitoneally, solved in 0.1 ml corn oil (Sigma Aldrich). In addition, a positive control group (n = 6) was given DMBA alone, as mentioned. Twenty-four hours after DMBA exposure, the animals were sacrificed by cervical dislocation and then their liver, kidney, and spleen were removed. The experiment was conducted in compliance with the current ethical regulations and approved by Regional Animal Ethical Committee Pécs (Ethical license no.: BA02/2000-79/2017).

Isolation of total RNA

Total cellular RNA was isolated using TRIZOL reagent (MRTR118-20 Nucleotest Bio Ltd.) according to the manufacturer’s instructions. The quality of RNA was checked by NanoDrop absorption photometry and only RNA fractions with A> 2.0 at 260/280 nm were used for the RT-PCR process.

Reverse Transcription-Polymerase Chain Reaction (RT-PCR)

The one-step PCR, including reverse transcription and target amplification, was performed using Kapa SYBR FAST One-step RTQCR kit (Kapa Biosystems) in a 96-well plate, on a LightCycler 480 qPCR platform, according to the manufacturer’s instructions.

Temperature program was set as follows: 5 minutes incubation at 42°C, followed by a 3 minute incubation at 95°C, then 45 cycles were performed (95°C– 5 s, 56°C– 15s, 72°C– 5s) and a fluorescent reading was made at the end of each cycle. Each run was performed with melting curve analysis (95°C– 5s, 65°C– 60s, 97°C ∞) to confirm the specificity of the amplification. The reaction mixture was the following: 10 μl KAPA SYBR FASTqPCR Master Mix, 0.4 μl KAPA RT Mix, 0.4 μl dUTP, 0.4 μl primers, 5 μl miRNA template supplemented with sterile double-distilled water to a total volume of 20 μl.

Primer sequences for the mTORC1 gene, the examined mRNAs (miR-330, miR-29a, miR-9-1, miR-9-3) and the internal control gene (mouse U6) are shown in Table 3. Primers were synthetized by Integrated DNA Technologies (Bio-Sciences), sequences are from previous publications [27, 28].

Table 3
Primer sequences (5’-3’) of the mTORC1 gene, of the examined miRNAs (miR-330, miR-29a, miR-9-1, miR-9-3) and of the internal control gene (mouse U6).
FORWARDREVERSE
miR-330GACCCTTTGGCGATCTCTGCTGTGCTTTGCTCGTTGGAT
mir-29aCCCCTTAGAGGATGACTGATTTCAACCGATTTCAGATGGTGCT
miR-9-1CGGGGTTGGTTGTTATCTTTTGGGGTTATTTTTACTTTCGGTTA
miR-9-3GCCCGTTTCTCTCTTTGGTTTCTAGCTTTATGACGGCTCTGTGG
mTORC1AAGGCCTGATGGGATTTGGTGTCAAGTACACGGGGCAAG
mouse U6CGCTTCGGCAGCACATATACTTCACGAATTTGCGTGTCAT

Calculation and statistical analysis

Relative miRNA expression levels were calculated and compared using the 2-ΔΔCT method. During the statistical analysis for the testing the distribution of results we used the Kolmogorov-Smirnov test. To compare averages we used the Levene’s type F-probe and T-probe. IBM SPSS 21 statistical software was used for calculations and analysis. We determined the level of statistical significance at a p value <0.05.

Results

Feeding with olive oil-containing diet significantly (p <0.001) reduced the expression of miR-124-1 (p = 0.001), miR-9-3 (p = 0.035), and mTORC1 (p = 0.002) compared to the DMBA control (Fig 1).

Liver of olive oil-consuming mice.
Fig 1

Liver of olive oil-consuming mice.

The expression pattern of miR-134, miR-132, miR-124-1, miR-9-3, and mTOR relative to DMBA-induced expression in the liver of DMBA- and olive oil-treated mice.

Similarly, the expression of miR-124-1 (p = 0.034), miR-9-3 (p = 0.009) and mTORC1 (p = 0.003) significantly decreased in the spleen as a result of the above mentioned feeding (Fig 2).

Spleen of olive oil-consuming mice.
Fig 2

Spleen of olive oil-consuming mice.

The expression pattern of miR-134, miR-132, miR-124-1, miR-9-3 and mTOR relative to DMBA-induced expression in the spleen of DMBA- and olive oil-treated mice.

The expression of miR-134 (p <0.001), miR-132 (p <0.001) and miR-9-3 (p <0.001) and miR-124-1 (p = 0.01), but not of mTORC1 gene, significantly decreased in the kidneys compared to the DMBA control (Fig 3).

Kidneys of olive oil-consuming mice.
Fig 3

Kidneys of olive oil-consuming mice.

The expression patterns of miR-134, miR-132, miR-124-1, miR-9-3, and mTOR relative to DMBA-induced expression in the kidneys of DMBA- and olive oil-treated mice.

Consumption of TFA-containing diet significantly increased the expression of miR-134 (p <0.001), miR-132 (p <0.001), miR-124-1 (p <0.001), miR-9-3 (p <0.001) and mTORC1 (p <0.001), as well, in the liver of animals compared to the DMBA control (Fig 4).

Liver of olive TFA-treated mice.
Fig 4

Liver of olive TFA-treated mice.

The expression patterns of miR-134, miR-132, miR-124-1, miR-9-3 and mTOR relative to DMBA-induced expression in the liver of DMBA- and TFA-treated mice.

TFA also significantly (p> 0.001) increased the expression of miR-134 (p> 0.001), miR-132 (p> 0.001), miR-124-1 (p> 0.001), miR-9-3 (p> 0.001) in the spleen and kidneys compared to the DMBA control, but the gene expression of mTORC1 was not significantly increased (Figs 5 and 6).

Spleen of olive TFA-treated mice.
Fig 5

Spleen of olive TFA-treated mice.

The expression patterns of miR-134, miR-132, miR-124-1, miR-9-3 and mTOR relative to DMBA-induced expression in the spleen of DMBA- and TFA-treated mice.

Kidneys of olive TFA-treated mice.
Fig 6

Kidneys of olive TFA-treated mice.

The expression patterns of miR-134, miR-132, miR-124-1, miR-9-3 and mTOR relative to DMBA-induced expression in the kidneys of DMBA- and TFA-treated mice.

Discussion

Oleuropein and oleocanthal, the water-soluble polyphenols of olive oil are absorbed from the small intestine and reach the spleen and liver [29], where they exert a protective effect against free radical-induced oxidative stress [30, 31] mainly through their cell membrane protective properties [32]. Oleuropein is able to inhibit NF-κB activation [33, 34] and to increase intracellular GSH levels, which is usually reduced by the free radicals [3537]. This may lead to a decrease in the expression of miR-134, miR-132 and miR124-1 (via the mentioned negative feedback mechanisms) and to a significant reduction in the amount of overexpressed miR-9-3 associated with the DMBA treatment (Figs 13). This is supported by the direct β-catenin inhibitory effect of PUFA, that leads to a significant decrease of C-MYC [38]. Furthermore, P300 and miR-132 cross-regulate each other’s expression [23]. Expression of BIRC3 and miR-124 showed a negative correlation [24] suggesting a negative feedback loop, while ICAM-1 positively modulates miR-124 expression [39]. These data explain the significant decrease of miR-124 in the olive oil-consuming group in all organs examined, and its significant overexpression in the TFA consuming group (since both the earlier mentioned TLA and EA increase the amount of ICAM-1) [9] (Figs 16). Certainly, the protective effect of water-soluble oleuropein caused the strong and significant decrease of miR-134 and miR-132 in the kidney via the mentioned negative feedback regulation [39] (Fig 3). The significant decrease of mTOR gene expression seen both in the liver and in the spleen was also due to the potent inhibitory effect of oleocanthal on mTOR activity [40] (Figs 1 and 2).

The weaker, non-significant decrease in miR-134 and miR-132 and the significant decrease in miR-124 in the liver and spleen (Figs 1 and 2) in the group consuming olive oil seem to contradict the antitumor effect of olive oil, since reduced expression was also observed for miR-134, miR-132, and miR-124 in manifest HCC [19], as well as for miR-134 in RCC [19]. (The expression of miR-124 in HCC is contradictive Table 1, [19, 24]). In addition, miR-9 also inhibits HCC progression [25], and it has been shown that a decrease in miR-9-3 indicates the development of malignant tumors as an early biomarker [41]. However, DMBA-induced elevated expression of MYC [42] and MYCN oncoproteins cause an increase of miR-9 expression in tumor cells, which (this time via a positive feedback mechanism, supporting oncogenes)–through the amplification of E-cadherin–induces further increase of C-MYC expression [43, 44]. This, in contrast to the above, promotes the formation of HCC, that is supported by the result of our previous article [26], where miR-9-3 expression of female CBA/CA mice as a result of DMBA exposure resulted in a particularly large, significant increase. mTOR signaling pathway activating mutations have already been identified in a wide range of human malignancies [45], for example in RCC [46]. Activation of the PI3-K/Akt/mTOR signaling pathway induces a number of oncogenic processes that contribute to the growth, survival, and proliferation of tumor cells, for example cyclins, C-MYC and ornithine decarboxylase [46]. Also mTOR in RCC cells through phospholipase D enhances the expression of both Hypoxia-inducible factor 1-alpha (HIF-1α) and HIF-2α [46, 47]. On the other hand, DNA damage inhibits mTORC1 through activting p53-dependent transcription, as well as TSC2 and phosphatase and tensin homolog deleted on chromosome 10 (PTEN) [47]. Thus, our results with the olive oil consuming group are explained by the negative feedback mechanisms, that are often involved in the regulation of the expression of miRs [48] (Figs 1 and 3).

However, the metabolism of DMBA leads to the appearance of reactive oxygen species (ROS) [49, 50] which contributes to the harmful effects of TFAs [8]. Furthermore, ROS has also been shown to induce cytokines (TNF, IL1, IL6), to increase the amount of specific transcription factors (e.g., NF-κB) and to reduce the level of protective GSH [9, 51].

In addition, if IL1β is present in high amounts, it stimulates inflammatory growth factors such as TNF, matrix metalloproteinases (MMPs), etc. [52]. Both the MMPs and TNF (in a redundant manner) promote the malignant transformation of cells, as well as their progression [53], e.g., by activation of NF-κB [52, 54, 55], which inhibits the expression of the anticancer miR-134 and P53 genes [56]. Indeed, DMBA-treated mice showed increased levels of interleukin 1β (IL1β), interleukin 6 (IL6), and tumor necrosis factor (TNF), which ultimately increased the possibility of malignant transformation [57]. These effects may explain the effect of TFA in the organs examined (Figs 46).

It can generally be stated that in each of the organs examined in the group consuming TFA-containing diet, the miRs tested showed a nearly opposite expression pattern compared to the groups consuming olive oil. This is also consistent with the negative feedback mechanisms reported in the literature [26, 58], as well as with the probable negative feedback mechanisms [59, 60]. The only exception is the expression of the mTOR gene in the kidneys, which can be attributed to the resultant of multiple effects. On the one hand, as TFA may have induced mTOR expression in the liver of mice, it is also TFA that blocks transforming growth factor-β (TGF-β) receptors in the kidneys, leading to a decrease in PTEN [26]. PTEN through the inhibition of PI3-K is an inhibitor of MTORC1, as well–moreover, according to our present knowledge this inhibition lacks negative feedback [26]. Furthermore, tumor suppressor effect of “tuberous sclerosis complex 2” protein (TSC2) activated by ROS induced “ataxia-telangiectasia mutated” (ATM) protein may have also decreased the expression of mTORC1 gene [61]. Our results in the spleen as well as in the kidneys of the studied animals consuming TFA show, that these multiple effects regulating the expression of the mTORC1 gene balance each other–also taking into account the related mTOR-decreasing effect exerted by the above mentioned miR-132 [62] (Fig 7).

Summary of molecular mechanisms and signl transductions.
Fig 7

Summary of molecular mechanisms and signl transductions.

The harmfull effects induced signal transductions and the chemopreventive effects too influence the expression of miR-134, miR-132, miR-124-1, miR-9-3 and mTOR.

Thus, these effects causing constitutive transcriptional activation and proto-oncogene to oncogene mutations–and the corresponding miR expression pattern–are specific to manifest carcinomas (and to in vitro cancer cell cultures) [19, 21, 22, 24]. However, the miR and mTOR gene expression patterns in our study, as early biomarkers, can rather be considered as responses to biological effects on the organs studied.

Conclusions

The expression of miR-134, miR-132, miR-124-1, and mir-9-3 indicated the chemopreventive effect of olive oil, as well as the carcinogenic effect of TFA (Figs 16). Our results confirmed the central role of inducible inflammatory signaling pathways among the mechanisms of the effects of different types of FAs on tumorigenesis. This is also the case for the expression pattern of both miRs and the mTOR gene, that is for example supported by ROS, NF-κB activated by inflammatory signaling agents, PTEN, and the level of accumulated ICAM-1 protein may have a key role [63]. We can conclude, that the expression patterns of the miR-134, miR-132, miR-124-1, mir-9-3, and mTORC1 genes, as early biomarkers of carcinogenic and chemopreventive effects, differ from the expression patterns of manifest tumors and in vitro cell cultures Table 1, [19, 21, 22, 24, 45, 46]. In general, our results suggest the great importance of negative feedback regulatory mechanisms. This important observation draws attention to the fact that gene expressions measured in tumors may be completely different from the expressions of the same genes in the period before tumor development.

However, in contrast to our expectations, in the animal model used in the present study design, the expression of the mTORC1 gene in the kidneys did not prove to be a suitable biomarker–to indicate the potential chemopreventive or carcinogenic/co-carcinogenic effects of either olive oil or TF consumption (Figs 3 and 6). It is very likely that this is because mTOR is driven by effects that also play an important role in inflammatory biology and in the cell cycle–and consequently complex (and even partially cross-regulatory) effects [22], which can also quench each other’s gene expression effects.

Acknowledgements

The authors express their special thanks to Péter Lajosházi for valuable technical assistance preparing Fig 7.

References

K.Hemminki Environmental Carcinogens. In: C.S.Cooper, P.L.Grover (eds) Chemical Carcinogenesis and Mutagenesis I. Handbook of Experimental Pharmacology. 1990 vol 94 / 1. Springer, Berlin, Heidelberg 10.1007/978-3-642-74775-5_2

CBosetti, CLa Vecchia, RTalamini, ENegri, FLevi, LDal Maso, et al Food groups and laryngeal cancer risk: a case-control study from Italy and Switzerland. Int J Cancer. 2002;100(3):35560. 10.1002/ijc.10485 .

CPelucchi, CBosetti, ENegri, LLipworth, CLa Vecchia. Olive oil and cancer risk: an update of epidemiological findings through 2010. Curr Pharm Des. 2011;17(8):80512. 10.2174/138161211795428920 .

PZhuang, YZhang, WHe, XChen, JChen, LHe, et al Dietary Fats in Relation to Total and Cause-Specific Mortality in a Prospective Cohort of 521 120 Individuals With 16 Years of Follow-Up. Circ Res. 2019 3;124(5):757768. 10.1161/CIRCRESAHA.118.314038 .

LLipworth, MEMartínez, JAngell, CCHsieh, DTrichopoulos. Olive oil and human cancer: an assessment of the evidence. Prev Med. 1997 Mar-Apr;26(2):18190. 10.1006/pmed.1996.9977 .

RWOwen, AGiacosa, WEHull, RHaubner, BSpiegelhalder, HBartsch. The antioxidant/anticancer potential of phenolic compounds isolated from olive oil. Eur J Cancer. 2000 6;36(10):123547. 10.1016/s0959-8049(00)00103-9 .

JAnjom-Shoae, OSadeghi, BLarijani, AEsmaillzadeh. Dietary intake and serum levels of trans fatty acids and risk of breast cancer: A systematic review and dose-response meta-analysis of prospective studies. Clin Nutr. 2020 3;39(3):755764. 10.1016/j.clnu.2019.03.024 Epub 2019 Mar 27. .

DMozaffarian, MBKatan, AAscherio, MJStampfer, WCWillett. Trans fatty acids and cardiovascular disease. N Engl J Med. 2006 4 13;354(15):160113. 10.1056/NEJMra054035 .

DBryk, DZapolska-Downar, MMalecki, KHajdukiewicz, DSitkiewicz. Trans fatty acids induce a proinflammatory response in endothelial cells through ROS-dependent nuclear factor-κB activation. J Physiol Pharmacol. 2011 4;62(2):22938. .

10 

EPikarsky, RMPorat, IStein, RAbramovitch, SAmit, SKasem, et al NF-kappaB functions as a tumour promoter in inflammation-associated cancer. Nature. 2004 9 23;431(7007):4616. 10.1038/nature02924 Epub 2004 Aug 25. .

11 

CFortes, FForastiere, SFarchi, SMallone, TTrequattrinni, FAnatra, et al The protective effect of the Mediterranean diet on lung cancer. Nutr Cancer. 2003;46(1):307. 10.1207/S15327914NC4601_04 .

12 

MTBrinkman, FBuntinx, EKellen, MCVan Dongen, PCDagnelie, EMuls, et al Consumption of animal products, olive oil and dietary fat and results from the Belgian case-control study on bladder cancer risk. Eur J Cancer. 2011; 47(3):43642. 10.1016/j.ejca.2010.09.027 Epub 2010 Oct 12. .

13 

LDu, APertsemlidis. microRNAs and lung cancer: tumors and 22-mers [published correction appears in Cancer Metastasis Rev. 2010; 29(4):801–2]. Cancer Metastasis Rev. 2010;29(1):109122. 10.1007/s10555-010-9204-9

14 

IVannini, FFanini, MFabbri. MicroRNAs as lung cancer biomarkers and key players in lung carcinogenesis. Clin Biochem. 2013 7;46(10–11):91825. 10.1016/j.clinbiochem.2013.01.024 Epub 2013 Feb 8. Erratum in: Clin Biochem. 2019 Jan;63:162. Erratum in: Clin Biochem. 2019 Jun;68:58. .

15 

JMLuk, JBurchard, CZhang, AMLiu, KFWong, FHShek, et al DLK1-DIO3 genomic imprinted microRNA cluster at 14q32.2 defines a stemlike subtype of hepatocellular carcinoma associated with poor survival. J Biol Chem. 2011 9 2;286(35):3070613. 10.1074/jbc.M111.229831 Epub 2011 Jul 7. ; PMCID: PMC3162431.

16 

HBartsch, JNair. New DNA-based biomarkers for oxidative stress and cancer chemoprevention studies. Eur J Cancer. 2000 6;36(10):122934. 10.1016/s0959-8049(00)00095-2 .

17 

JYPan, FZhang, CCSun, SJLi, GLi, FYGong, et al miR-134: A Human Cancer Suppressor? Mol Ther Nucleic Acids. 2017 3 17;6:140149. 10.1016/j.omtn.2016.11.003 Epub 2016 Dec 10. ; PMCID: PMC5363400.

18 

CYin, PQWang, WPXu, YYang, QZhang, BFNing, et al Hepatocyte nuclear factor-4α reverses malignancy of hepatocellular carcinoma through regulating miR-134 in the DLK1-DIO3 region. Hepatology. 2013 12;58(6):196476. 10.1002/hep.26573 Epub 2013 Oct 22. .

19 

RZha, WGuo, ZZhang, ZQiu, QWang, JDing, et al Genome-wide screening identified that miR-134 acts as a metastasis suppressor by targeting integrin β1 in hepatocellular carcinoma. PLoS One. 2014 2 3;9(2):e87665 10.1371/journal.pone.0087665 ; PMCID: PMC3912066.

20 

AMSchooley, NMAndrews, HZhao, CLAddison. β1 integrin is required for anchorage-independent growth and invasion of tumor cells in a context dependent manner. Cancer Lett. 2012 3 28;316(2):15767. 10.1016/j.canlet.2011.10.032 Epub 2011 Oct 30. .

21 

YLiu, MZhang, JQian, MBao, XMeng, SZhang, et al miR-134 functions as a tumor suppressor in cell proliferation and epithelial-to-mesenchymal Transition by targeting KRAS in renal cell carcinoma cells. DNA Cell Biol. 2015 6;34(6):42936. 10.1089/dna.2014.2629 Epub 2015 Mar 26. ; PMCID: PMC4485881.

22 

KLiu, XLi, YCao, YGe, JWang, BShi. MiR-132 inhibits cell proliferation, invasion and migration of hepatocellular carcinoma by targeting PIK3R3. Int J Oncol. 2015 10;47(4):158593. 10.3892/ijo.2015.3112 Epub 2015 Aug 4. .

23 

DLagos, GPollara, SHenderson, FGratrix, MFabani, RSMilne, et al miR-132 regulates antiviral innate immunity through suppression of the p300 transcriptional co-activator. Nat Cell Biol. 2010 5;12(5):5139. 10.1038/ncb2054 Epub 2010 Apr 25. .

24 

JCao, JQiu, XWang, ZLu, DWang, HFeng, et al Identification of microRNA-124 in regulation of Hepatocellular carcinoma through BIRC3 and the NF-κB pathway. J Cancer. 2018 7 30;9(17):30063015. 10.7150/jca.25956 ; PMCID: PMC6134807.

25 

JZhang, JCheng, ZZeng, YWang, XLi, QXie, et al Comprehensive profiling of novel microRNA-9 targets and a tumor suppressor role of microRNA-9 via targeting IGF2BP1 in hepatocellular carcinoma. Oncotarget. 2015 12 8;6(39):4204052. 10.18632/oncotarget.5969 ; PMCID: PMC4747208.

26 

ATomesz, LSzabo, RMolnar, ADeutsch, RDarago, DMathe, et al Effect of 7,12-Dimethylbenz(α)anthracene on the Expression of miR-330, miR-29a, miR-9-1, miR-9-3 and the mTORC1 Gene in CBA/Ca Mice. In Vivo. 2020 Sep-Oct;34(5):23372343. 10.21873/invivo.12046 ; PMCID: PMC7652467.

27 

BShor, DCavender, CHarris. A kinase-dead knock-in mutation in mTOR leads to early embryonic lethality and is dispensable for the immune system in heterozygous mice. BMC Immunol. 2009 5 20;10:28 10.1186/1471-2172-10-28 ; PMCID: PMC2698930.

28 

SUchida, KHara, AKobayashi, HFunato, THobara, KOtsuki, et al Early life stress enhances behavioral vulnerability to stress through the activation of REST4-mediated gene transcription in the medial prefrontal cortex of rodents. J Neurosci. 2010 11 10;30(45):1500718. 10.1523/JNEUROSCI.1436-10.2010 ; PMCID: PMC6633839.

29 

BBermúdez, YMPacheco, SSergio Lopez, RAbia, FJGMuriana. Digestion and absorption of olive oil. Grasas y Aceites. 2004 55(1) 110.

30 

ANakbi, WTayeb, SDabbou, MIssaoui, AKGrissa, NAttia, et al Dietary olive oil effect on antioxidant status and fatty acid profile in the erythrocyte of 2,4-D- exposed rats. Lipids Health Dis. 2010 8 25;9:89 10.1186/1476-511X-9-89 ; PMCID: PMC2936360.

31 

ISeiquer, ARueda, MOlalla, CCabrera-Vique. Assessing the bioavailability of polyphenols and antioxidant properties of extra virgin argan oil by simulated digestion and Caco-2 cell assays. Comparative study with extra virgin olive oil. Food Chem. 2015 12 1;188:496503. 10.1016/j.foodchem.2015.05.006 Epub 2015 May 8. .

32 

CFerreri, AMasi, ASansone, GGiacometti, AVLarocca, GMenounou, et al Fatty Acids in Membranes as Homeostatic, Metabolic and Nutritional Biomarkers: Recent Advancements in Analytics and Diagnostics. Diagnostics (Basel). 2016 12 22;7(1):1 10.3390/diagnostics7010001 ; PMCID: PMC5373010.

33 

RHornedo-Ortega, ABCerezo, RMde Pablos, SKrisa, TRichard, MCGarcía-Parrilla, et al Phenolic Compounds Characteristic of the Mediterranean Diet in Mitigating Microglia-Mediated Neuroinflammation. Front Cell Neurosci. 2018 10 23;12:373 10.3389/fncel.2018.00373 ; PMCID: PMC6206263.

34 

JPark, JSMin, UChae, JYLee, KSSong, HSLee, et al Anti-inflammatory effect of oleuropein on microglia through regulation of Drp1-dependent mitochondrial fission. J Neuroimmunol. 2017 5 15;306:4652. 10.1016/j.jneuroim.2017.02.019 Epub 2017 Mar 1. .

35 

LGiusti, CAngeloni, MCBarbalace, SLacerenza, FCiregia, MRonci, et al A Proteomic Approach to Uncover Neuroprotective Mechanisms of Oleocanthal against Oxidative Stress. Int J Mol Sci. 2018 8 8;19(8):2329 10.3390/ijms19082329 ; PMCID: PMC6121693.

36 

PKouka, GTsakiri, DTzortzi, SDimopoulou, GSarikaki, PStathopoulos, et al The Polyphenolic Composition of Extracts Derived from Different Greek Extra Virgin Olive Oils Is Correlated with Their Antioxidant Potency. Oxid Med Cell Longev. 2019 3 20;2019:1870965 10.1155/2019/1870965 ; PMCID: PMC6446106.

37 

JLópez-Miranda, FPérez-Jiménez, ERos, RDe Caterina, LBadimón, MICovas, et al Olive oil and health: summary of the II international conference on olive oil and health consensus report, Jaén and Córdoba (Spain) 2008. Nutr Metab Cardiovasc Dis. 2010 5;20(4):28494. 10.1016/j.numecd.2009.12.007 Epub 2010 Mar 19. .

38 

MNotarnicola, VTutino, VDe Nunzio, FDituri, MGCaruso, GGiannelli. Dietary ω-3 Polyunsaturated Fatty Acids Inhibit Tumor Growth in Transgenic ApcMin/+ Mice, Correlating with CB1 Receptor Up-Regulation. Int J Mol Sci. 2017 2 24;18(3):485 10.3390/ijms18030485 ; PMCID: PMC5372501.

39 

WGu, LYao, LLi, JZhang, ATPlace, RDMinshall, et al ICAM-1 regulates macrophage polarization by suppressing MCP-1 expression via miR-124 upregulation. Oncotarget. 2017 12 5;8(67):111882111901. 10.18632/oncotarget.22948 ; PMCID: PMC5762366.

40 

MAKhanfar, SKBardaweel, MRAkl, KAEl Sayed. Olive Oil-derived Oleocanthal as Potent Inhibitor of Mammalian Target of Rapamycin: Biological Evaluation and Molecular Modeling Studies. Phytother Res. 2015 11;29(11):177682. 10.1002/ptr.5434 Epub 2015 Aug 7. ; PMCID: PMC5051273.

41 

MAHildebrandt, JGu, JLin, YYe, WTan, PTamboli, et al Hsa-miR-9 methylation status is associated with cancer development and metastatic recurrence in patients with clear cell renal cell carcinoma. Oncogene. 2010 10 21;29(42):57248. 10.1038/onc.2010.305 Epub 2010 Aug 2. .

42 

FBudán, TVarjas, GNowrasteh, IPrantner, ZVarga, AEmber, et al Early modification of c-myc, Ha-ras and p53 expressions by chemical carcinogens (DMBA, MNU). In Vivo. 2009 Jul-Aug;23(4):5918. .

43 

PJMorin. beta-catenin signaling and cancer. Bioessays. 1999 12;21(12):102130. 10.1002/(SICI)1521-1878(199912)22:1&lt;1021::AID-BIES6&gt;3.0.CO;2-P .

44 

LMa, JYoung, HPrabhala, EPan, PMestdagh, DMuth, et al miR-9, a MYC/MYCN-activated microRNA, regulates E-cadherin and cancer metastasis. Nat Cell Biol. 2010 3;12(3):24756. 10.1038/ncb2024 Epub 2010 Feb 21. ; PMCID: PMC2845545.

45 

TSato, ANakashima, LGuo, KCoffman, FTamanoi. Single amino-acid changes that confer constitutive activation of mTOR are discovered in human cancer. Oncogene. 2010 5 6;29(18):274652. 10.1038/onc.2010.28 Epub 2010 Mar 1. ; PMCID: PMC2953941.

46 

CBattelli, DCCho. mTOR inhibitors in renal cell carcinoma. Therapy. 2011 7;8(4):359367. 10.2217/thy.11.32 ; PMCID: PMC3164983.

47 

MLaplante, DMSabatini. mTOR signaling in growth control and disease. Cell. 2012 4 13;149(2):27493. 10.1016/j.cell.2012.03.017 ; PMCID: PMC3331679.

48 

ASzpechcinski, MFlorczuk, KDuk, AZdral, SRudzinski, MBryl, et al The expression of circulating miR-504 in plasma is associated with EGFR mutation status in non-small-cell lung carcinoma patients. Cell Mol Life Sci. 2019 9;76(18):36413656. 10.1007/s00018-019-03089-2 Epub 2019 Apr 5. ; PMCID: PMC6697756.

49 

YCao, JWang, RHenry-Tillman, VSKlimberg. Effect of 7,12-dimethylbenz[a]anthracene (DMBA) on gut glutathione metabolism. J Surg Res. 2001 9;100(1):13540. 10.1006/jsre.2001.6229 .

50 

P.Storz Reactive oxygen species in tumor progression. Front Biosci. 2005 5 1;10:188196. 10.2741/1667 .

51 

SReuter, SCGupta, MMChaturvedi, BBAggarwal. Oxidative stress, inflammation, and cancer: how are they linked? Free Radic Biol Med. 2010;49(11):16031616. 10.1016/j.freeradbiomed.2010.09.006

52 

RNApte, SDotan, MElkabets, MRWhite, EReich, YCarmi, et al The involvement of IL-1 in tumorigenesis, tumor invasiveness, metastasis and tumor-host interactions. Cancer Metastasis Rev. 2006 9;25(3):387408. 10.1007/s10555-006-9004-4 .

53 

WGStetler-Stevenson, AEYu. Proteases in invasion: matrix metalloproteinases. Semin Cancer Biol. 2001 4;11(2):14352. 10.1006/scbi.2000.0365 .

54 

CBYeh, MJHsieh, YHHsieh, MHChien, HLChiou, SFYang. Antimetastatic effects of norcantharidin on hepatocellular carcinoma by transcriptional inhibition of MMP-9 through modulation of NF-kB activity. PLoS One. 2012;7(2):e31055 10.1371/journal.pone.0031055 Epub 2012 Feb 7. Erratum in: PLoS One. 2017 Feb 6;12 (2):e0171900. ; PMCID: PMC3280344.

55 

H.Wajant The role of TNF in cancer. Results Probl Cell Differ. 2009;49:115. 10.1007/400_2008_26 .

56 

TShuang, MWang, YZhou, CShi, DWang. NF-κB1, c-Rel, and ELK1 inhibit miR-134 expression leading to TAB1 upregulation in paclitaxel-resistant human ovarian cancer. Oncotarget. 2017 4 11;8(15):2485324868. 10.18632/oncotarget.15267 ; PMCID: PMC5421894.

57 

VRDe Souza, WKCabrera, AGalvan, OGRibeiro, MDe Franco, FVorraro, et al Aryl hydrocarbon receptor polymorphism modulates DMBA-induced inflammation and carcinogenesis in phenotypically selected mice. Int J Cancer. 2009 3 15;124(6):147882. 10.1002/ijc.24066 .

58 

ASzpechcinski, MFlorczuk, KDuk, AZdral, SRudzinski, MBryl, et al The expression of circulating miR-504 in plasma is associated with EGFR mutation status in non-small-cell lung carcinoma patients. Cell Mol Life Sci. 2019 9;76(18):36413656. 10.1007/s00018-019-03089-2 Epub 2019 Apr 5. ; PMCID: PMC6697756.

59 

JCao, JQiu, XWang, ZLu, DWang, HFeng, et al Identification of microRNA-124 in regulation of Hepatocellular carcinoma through BIRC3 and the NF-κB pathway. J Cancer. 2018 7 30;9(17):30063015. 10.7150/jca.25956 ; PMCID: PMC6134807.

60 

WGu, LYao, LLi, JZhang, ATPlace, RDMinshall, et al ICAM-1 regulates macrophage polarization by suppressing MCP-1 expression via miR-124 upregulation. Oncotarget. 2017 12 5;8(67):111882111901. 10.18632/oncotarget.22948 ; PMCID: PMC5762366.

61 

AAlexander, SLCai, JKim, ANanez, MSahin, KHMacLean, et al ATM signals to TSC2 in the cytoplasm to regulate mTORC1 in response to ROS. Proc Natl Acad Sci U S A. 2010 3 2;107(9):41538. 10.1073/pnas.0913860107 Epub 2010 Feb 16. Erratum in: Proc Natl Acad Sci U S A. 2012 May 22;109(21):8352. ; PMCID: PMC2840158.

62 

KLiu, XLi, YCao, YGe, JWang, BShi. MiR-132 inhibits cell proliferation, invasion and migration of hepatocellular carcinoma by targeting PIK3R3. Int J Oncol. 2015 10;47(4):158593. 10.3892/ijo.2015.3112 Epub 2015 Aug 4. .

63 

AJPantuck, DBSeligson, TKlatte, HYu, JTLeppert, LMoore, et al Prognostic relevance of the mTOR pathway in renal cell carcinoma: implications for molecular patient selection for targeted therapy. Cancer. 2007 6 1;109(11):225767. 10.1002/cncr.22677 .