PLoS ONE
Home De novo assembly, annotation, marker discovery, and genetic diversity of the Stipa breviflora Griseb. (Poaceae) response to grazing
<i>De novo</i> assembly, annotation, marker discovery, and genetic diversity of the <i>Stipa breviflora</i> Griseb. (Poaceae) response to grazing
De novo assembly, annotation, marker discovery, and genetic diversity of the Stipa breviflora Griseb. (Poaceae) response to grazing

Competing Interests: The authors have declared that no competing interests exist.

Article Type: research-article Article History
Abstract

Grassland is one of the most widely-distributed ecosystems on Earth and provides a variety of ecosystem services. Grasslands, however, currently suffer from severe degradation induced by human activities, overgrazing pressure and climate change. In the present study, we explored the transcriptome response of Stipa breviflora, a dominant species in the desert steppe, to grazing through transcriptome sequencing, the development of simple sequence repeat (SSR) markers, and analysis of genetic diversity. De novo assembly produced 111,018 unigenes, of which 88,164 (79.41%) unigenes were annotated. A total of 686 unigenes showed significantly different expression under grazing, including 304 and 382 that were upregulated and downregulated, respectively. These differentially expressed genes (DEGs) were significantly enriched in the “alpha-linolenic acid metabolism” and “plant-pathogen interaction” pathways. Based on transcriptome sequencing data, we developed eight SSR molecular markers and investigated the genetic diversity of S. breviflora in grazed and ungrazed sites. We found that a relatively high level of S. breviflora genetic diversity occurred under grazing. The findings of genes that improve resistance to grazing are helpful for the restoration, conservation, and management of desert steppe.

Yan,Ren,Liu,Ding,Niu,and Šiler: De novo assembly, annotation, marker discovery, and genetic diversity of the Stipa breviflora Griseb. (Poaceae) response to grazing

Introduction

Chinese grasslands are diverse and constitute the third largest grassland area worldwide, covering 41.7% of the country’s territory and stretching from northern China to the Qinghai-Tibetan Plateau [13]. These grasslands are currently in danger of degradation owing to climate change and anthropogenic activities, and over 33% of the degradation is due to overgrazing [4, 5]. Long-term overgrazing impacts species richness, community biomass, and soil quality [68]. However, plants can adapt to grazing pressure by developing certain characteristics, such as small sizes, fast growth, short life-spans, and low palatability, to avoid livestock feeding and increase the survival rate [9]. Stipa species (Poaceae) are the most conspicuous grassland plants distributed throughout the Eurasian Steppe and are established as zonal vegetation in the Inner Mongolia grassland [1013]. S. breviflora Griseb. is one of the dominant species and valuable forage resource in the desert steppe and is characterized by palatability, rich nutrient content, and early greening. Additionally, this species has strong ecological adaptability to diverse environments and can be a codominant species with S. bungeana and S. krylovii in warm-temperate steppe and typical steppe, respectively [1419]. Although S. breviflora is vulnerable to climate change and grazing, it still has great potential for expansion and evolution via hybridization with other feather grasses [13, 17, 20]. Thus, there is a need for further elucidation of the adaptation of S. breviflora to grazing.

Genetic diversity is fundamental to biodiversity [21]. Climate factors, such as temperature and precipitation, and human activities impact genetic diversity, resulting in changes in genetic differentiation [22, 23]. Studies have shown that temperature is the key factor in determining the genetic differentiation of S. breviflora [14]. Anthropogenic activity, such as grazing, can increase, decrease, or have no significant effects on the genetic diversity of plants. In the genus Stipa, moderated grazing was found to promote the genetic diversity of S. grandis and S. krylovii [24]. Similar results were detected in the study by Shan et al. [25], and the genetic diversity of S. grandis under light grazing conditions was higher than that under no grazing. Other plants, such as Elymus nutans, had higher intrapopulation genetic diversity in three grazed areas than in ungrazed areas [26]. However, a negative relationship between grazing and genetic diversity was also observed. For example, Artemisia frigida displayed restricted gene flow and decreased genetic diversity under grazing [27]. In some cases, grazing had no significant effect on plant genetic diversity. Smith et al. [28] investigated the fine-scale spatial genetic structure in Bouteloua curtipendula var. caespitosa, Bouteloua gracilis and Poa ligularis and observed no differences in average gene diversity between populations of each species. A study on Festuca idahoensis revealed that grazing did not significantly alter their genetic diversity [29]. In summary, although plants respond to climate and human activities by changing their genetic diversity, the molecular mechanisms driving these changes remain poorly understood.

The next-generation sequencing (NGS) technology have provided an efficient way to generate an abundance of genomic data. Compared with traditional low-throughput EST (Expressed Sequence Tag) sequencing by Sanger technology, RNA-sequencing (RNA-seq) offers more transcripts for both marker development and gene discovery, helping us to explore the molecular mechanism of genetic diversity [30]. Using transcriptome sequencing, Ren et al. [31] developed 21 microsatellite markers of S. breviflora and tested the polymorphism in six related species. Klichowska et al. [32] mined 10 microsatellite markers of S. pennata using Illumina high-throughput. Transcriptome analysis has also been used to uncover the adaptive mechanisms of plants subjected to grazing. For Leymus chinensis, genes related to the systemic synthesis of jasmonate are activated during grazing [33]. Wang et al. [34] conducted de novo assembly to compare the transcriptomes of two alfalfa varieties that are tolerant and intolerant to grazing, and identified 21 differentially expressed responsive pathways. For S. grandis, individuals subjected to grazing develop smaller size than those not subjected to grazing, and the expression of wound-, drought-, and defense-related genes is altered [35]. However, the response of S. breviflora to grazing at the transcriptome level and the changes in genetic diversity remain unclear.

Considering the crucial position of S. breviflora in desert steppe and to meet the needs for exploring the adaptation mechanism of grasses to grazing, we took this species as an example to (1) investigate the transcriptome response to grazing; (2) develop simple sequence repeat (SSR) molecular markers based on transcriptome sequencing data; and (3) explore the impact of grazing on the genetic diversity. The present study provides insight into the adaptation mechanisms of plants under grazing.

Materials and methods

Collecting plant materials

The study area is in Wuchuan, Inner Mongolia Autonomous Region, China (41°47′-41°23′N, 110°31′-111°53′E) at an elevation of 1500–2000 m above sea level. This area belongs to the monsoon climate of medium latitudes. The mean annual precipitation and temperature are 354.1 mm and 2.6°C, respectively. We observed three ungrazed sites (codes 1, 2, and 3) and three grazed sites (codes 4, 5, and 6) (Table 1). The ungrazed sites have been fenced to prevent grazing for many years. In contrast, the grazed sites have been subjected to long-term heavy grazing. The area of each site is more than 1 hm2. These sites are distributed adjacently and are approximately around 2–10 km apart, indicating that they are under similar backgrounds of temperature and precipitation. The study was carried out in public land. No specific permissions are required for collecting samples, and no endangered or protected species are involved in study area.

Table 1
Information of the observed sites of S. breviflora.
CodePositionAltitude(m)UtilizationPlant community
1111.21°E, 41.13°N 1629fenced without grazingS. breviflora + S. krylovii
2111.26°E, 41.19°N1680fenced without grazingS. breviflora + S. krylovii + Thymus mongolicus
3111.19°E, 41.11°N1668fenced without grazingS. breviflora + S. krylovii
4111.19°E, 41.11°N1647sheep grazingS. breviflora + S. krylovii + Thymus mongolicus
5111.29°E, 41.25°N1614sheep grazingS. breviflora + Agropyron cristatum
6111.31°E, 41.29°N1572sheep grazingS. breviflora + S. krylovii + Cleistogenes squarrosa

In June 2016, we collected 33 samples at each site, with 3 samples for RNA-seq and 30 samples for genetic diversity analysis. For RNA-seq, we chose healthy and intact individuals in ungrazed sites, and chose individuals in obviously grazed patches in grazed sites. Samples for RNA-seq were rinsed with RNase-free dd water, mixed with equal amounts, stored in dry ice, and sent to the Beijing Genomics Institute (BGI, Shenzhen, China) for total RNA extraction and high-throughput sequencing. For genetic diversity analysis, we chose the healthy and intact individuals that were at least 10 m apart in both grazed and ungrazed populations. All samples were immediately frozen in liquid nitrogen and brought back to the Genetics Lab and stored at -80°C for genetic diversity analysis.

RNA preparation and cDNA library construction

The total RNA of each sample was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. RNA integrity was examined using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA), and poly (A) mRNA was isolated using Oligo (dT) beads. The mRNA fragments were used as templates for reverse transcription to obtain cDNA. After fragment ends were repaired, polymerase chain reaction (PCR) amplification was performed, followed by poly (A) ligation and fragment length selection to construct a cDNA library. To obtain a high-quality library, an Agilent 2100 Bioanalyzer and ABI StepOnePlus real-time PCR system were used for quality control analysis.

RNA-seq and de novo assembly

The libraries were sequenced using the Illumina HiSeq 4000 platform (Illumina, USA). The raw reads generated by sequencing were filtered by eliminating adaptor sequences and low-quality reads and then assembled by the Trinity program with the default parameters [36]. The longest transcripts of each gene were chosen as unigenes.

Unigene annotation

Unigenes were aligned using the basic local search tool (BLAST) [37] against databases, including the nucleotide collection (Nt, https://www.ncbi.nlm.nih.gov/), National Center for Biotechnology Information (NCBI) non-redundant protein (Nr, https://www.ncbi.nlm.nih.gov/), Cluster of Orthologous Groups (COG, http://www.ncbi.nlm.nih.gov/COG), Kyoto Encyclopedia of Genes and Genomes (KEGG, http://www.genome.jp/kegg) and Swiss-Prot (http://ftp.ebi.ac.uk/pub/databases/swissprot) databases. Blast2GO [38] was used to annotate the unigenes against gene ontology (GO, http://geneontology.org) based on the results of the Nr annotation.

InterProScan5 [39] was used for InterPro (http://www.ebi.ac.uk/interpro) annotation. According to the functional annotation results, the best-matched sequences were defined as complete coding sequences (CDS) of the corresponding unigenes and saved in FASTA format, with the following order of priority: Nr, SwissProt, KEGG, and COG. Moreover, the predicted CDS were used as a model to predict the unigenes without matches in the abovementioned database through modeling with ESTScan [40].

Differentially Expressed Gene (DEG) identification

The expression levels of each gene were calculated by RSEM [41]. Differential expression analysis of genes in grazed and ungrazed samples was performed using the NOIseq approach [42]. We set fold change ≥ 2.00 and probability ≥ 0.8 as thresholds to identify the genes that were expressed at a significantly different level.

Developing grazing-related SSRs

MISA [43] and Primer3 [44] were used to detect SSRs from the transcriptome and design primers, respectively. We selected 21 SSR molecular markers derived from DEGs to screen grazing-related SSRs and then determined the optimal annealing temperature by PCR amplification (S1 Table). Total genomic DNA was extracted using the TIANGEN plant genomic DNA kit (Tiangen Biotech, Beijing, China) for all samples following the manufacturer’s instructions. The quality and quantity of DNA were determined by using a NanoDrop 2000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA). The PCR amplification reaction mixture (25 μL) contained 1 μL template DNA (30–40 ng μL–1), 0.5 μL (10 pM) of each primer, 12.5 μL Premix Taq (TaKaRa Biotechnology Co., Dalian, Liaoning Province, China), and 10.5 μL double distilled water (ddH2O). The PCR amplification parameters were as follows: 4 min at 94°C; 35 cycles of 30 s at 94°C, 30 s at a primer-specific annealing temperature, 30 s at 72°C and a final extension step at 72°C for 10 min. PCR products were then separated using capillary electrophoresis and genotyped using an ABI 3730 DNA analyzer with a GeneScan 500 LIZ size standard (Applied Biosystems, Beijing, China). Finally, we screened eight primers with polymorphic loci (Table 2). Polymorphism information content (PIC) values of markers were calculated using Cervus 3.0.7 [45].

Table 2
Characteristics of eight microsatellite loci for S. breviflora.
Gene IDPrimer sequence (5'→3')Product sizeRepeatsTa(°C)aPICb
CL14453.Contig1GAGGAAGCGTCGATCGTGAC107(CGG)761.50.47
TGTCCACTTTCTGCTCCACG
Unigene12747GAGCGATGCAACGATTATATAGG116(CGACGC)558.30.38
CATCGTGAAGTGATAAGAAGCCT
CL616.Contig34AATCAGCTCGTCGGTATTTGAT124(GT)653.00.33
AGAGGGGAAGAACGAAATATCTG
CL1837.Contig15GGGGAGTTGGACTTGGTAGTG150(GGA)562.00.22
CTTAACCTCCCTTCTCCACCTT
CL15080.Contig2ATCGTCAAACTCCACCTAATCAA140(TC)1054.30.15
AGGCAATATTGGCAACTCACTC
CL966.Contig12CACTGGGTTCTCTTCGTCTCC237(GA)7gg(GA)752.50.35
TCTCCTCCTGCATCTTTCGTC
CL.5285.Contig5TATAGGCAGTGGGGAGACGA192(CTC)755.00.42
AGCTTCGAGGGATGAGGAGA
CL966.Contig15CACCGGATGCAAAGAAACCG221(GA)7gg(GA)752.50.14
CCTCCTGCATCTTTCGTCCTC

a Annealing temperature.

b Polymorphism information content.

Genetic diversity analysis

We used the eight abovementioned polymorphic SSR markers to analyze genetic diversity among grazed and ungrazed samples. First, GeneMarker version 2.6.0 (SoftGenetics, State College, PA, USA) was used to perform peak identification and fragment sizing. Then, we applied GenAlEx 6.5 [46] to convert the data format and to calculate the genetic parameters, including the observed number of alleles (Na), effective number of alleles (Ne), expected heterozygosity (He) and observed heterozygosity (Ho), gene flow (Nm), and Shannon’s information index (I). R version 3.6.3 was used to perform Student’s test to explore the relations of genetic parameters between grazed and ungrazed populations.

Results

De novo assembly and unigene annotation

After sequence assembly and redundancy removal, we obtained 111,018 unigenes totaling 125,503,270 bp with an average length of 1130 bp. The N50 and CG contents were 1852 bp and 49.38%, respectively, which demonstrated adequate assembly quality (Table 3). For the functional annotation, 88,164 unigenes (79.41%) matched records in seven databases. The quantity of annotated unigenes in each database was as follows: Nr, 79,283 (71.41%); Nt, 83,097 (74.85%); SwissProt, 57,827 (52.09%); KEGG, 63,044 (56.79%); COG, 37,880 (34.12%); InterPro, 51,305 (46.21%); and GO, 50,089 (45.12%) (Table 4).

Table 3
Statistical summary of S. breviflora transcriptome data.
Assembly statisticsRNA-seq
Number of unigenes111,018
Total length (bp)125,503,270
Mean length (bp) a1130
N50 (bp)b1852
GC (%)c49.38

a Mean length of the assembled sequences.

b The length of the content or unigene corresponding to the sequence, which is added to 50% of the total assembled bases when the assembled sequences are sorted from short to long.

c GC content.

Table 4
Summary of functional annotations of the assembled unigenes.
DatabaseNumber of unigene hitsPercentage (%)
Nr79,28371.41
Nt83,09774.85
SwissProt57,82752.09
KEGG63,04456.79
COG37,88034.12
Interpro51,30546.21
GO50,08945.12
Overall88,16479.41

Based on the NR annotation, we found species with genes homologous to S. breviflora. The results showed that 46.02% of unigene sequences matched Brachypodium distachyon, followed by other species (28.93%), Hordeum vulgare subsp. Vulgare (11.06%), Oryza sativa Japonica group (7.15%), and Aegilops tauschii (6.84%) (Fig 1).

Unigene homology searches against the NR database.
Fig 1

Unigene homology searches against the NR database.

We matched unigenes to the GO database to clarify the cellular function of the gene products. We found that 50,089 unigenes were matched to more than 50 functional items, which were divided into three main groups: biological process, cellular component, and molecular function (Fig 2). The largest subcategory of biological process was “metabolic process” (26,800), followed by “cellular process” (26,513). Of the cellular component, “cell” and “cell parts” showed the most matches with unigenes at 26,939 and 26,833, respectively. Among the molecular function category, “binding” and “catalytic activity” showed the most matches at 24,708 and 22,732, respectively.

GO classifications of the assembled unigenes.
Fig 2

GO classifications of the assembled unigenes.

With the aim of validating protein functions, the COG database was used to compare with unigenes. A total of 37,880 unigenes were annotated into 25 COG functional categories (Fig 3). The “general function prediction only” was the cluster with the most unigenes (10,786), followed by “transcription” (7184), “translation, ribosomal structure and biogenesis” (7048), “cell cycle control” (6488), and “function unknown” (6314), whereas only a few unigenes were assigned to “extracellular structures” and “nuclear structure”.

COG classifications of the assembled unigenes.
Fig 3

COG classifications of the assembled unigenes.

KEGG annotation was performed to identify the metabolic pathway to which unigenes belonged, and 63,044 unigenes had matches in the KEGG database. These unigenes were assigned to 133 pathways.

Differential expression and pathway analysis

Using the NOI approach, we identified 686 DEGs, including upregulated (304 DEGs) and downregulated (382 DEGs). Then, a similarity search of the DEGs in the KEGG database was performed to explore the pathways associated with a significant enrichment in response to grazing. We found that these DEGs were sorted into 100 pathways. As presented in Table 5, the main enriched pathways included “alpha-linolenic acid metabolism” and “plant-pathogen interaction”.

Table 5
The top ten KEGG enriched pathway of DEGs.
KEGG termsGene numberQ valuePathway ID
Alpha-linolenic acid metabolism132.90E-05***ko00592
Plant-pathogen interaction579.96E-04***ko04626
Pentose and glucuronate interconversions130.12ko00040
Diterpenoid biosynthesis50.12ko00904
Biosynthesis of secondary metabolites800.18ko01110
Starch and sucrose metabolism200.23ko00500
Linoleic acid metabolism40.27ko00591
Phenylpropanoid biosynthesis250.61ko00940
Sesquiterpenoid and triterpenoid biosynthesis30.61ko00909
Glutathione metabolism70.61ko00480

***q<0.001, significantly enriched pathway of DEGs.

Development and validation of grazing-related SSR markers

MISA was used to mine SSR markers from transcriptomes using the following criteria: mono-nucleotides with at least 12 repeats, di-nucleotides with 6 repeats, tri- and tetra-nucleotides with 5 repeats, and penta- and hexa-nucleotides with 4 repeats. We examined 111,018 sequences and identified 19,607 SSRs (S2 Table). Additionally, 11,963 tri-nucleotide SSRs and 386 quad-nucleotide SSRs accounted for 61.01% and 1.97% of all the SSRs, respectively, representing the most and the least of all SSR markers. The CCG/CGG trinucleotide repeats were the most abundant motifs detected in SSRs (5186, 26.45%), followed by the AG/CT (3117, 15.90%), AGG/CCT (2611, 13.32%), and AGC/CTG (1716, 8.75%) motifs (Table 6). The frequency of the remaining motifs accounted for 35.58% of the SSRs.

Table 6
Distribution of simple sequence repeat types in S. breviflora transcriptome.
SSR motifSSR motif numbersRatio (%)
Mono-nucleotide10595.40
AC/GT6783.46
AG/CT311715.90
AT/AT6243.18
CG/CG3771.92
Tri-nucleotide11,96361.01
AAC/GTT1490.76
AAG/CTT5762.94
AAT/ATT520.27
ACC/GGT8124.14
ACG/CGT5452.78
ACT/AGT520.27
AGC/CTG17168.75
AGG/CCT261113.32
ATC/ATG2641.35
CCG/CGG518626.45
Quad–nucleotide3861.97
Penta–nucleotide5422.76
Hexa–nucleotide8614.39

To develop grazing-related molecular markers, we preliminarily selected 21 DEGs and designed primers (S1 Table). After screening polymorphic SSRs, excluding primers with product sizes that did not meet the requirements and could not generate PCR products, eight grazing-related genes with SSR polymorphisms were found. In this study, PIC values ranged from 0.14 to 0.47, averaging 0.31, which indicated that these markers were informative and effective for genetic analysis (Table 2).

Effects of grazing on genetic diversity

The eight primers yielded 29 alleles for 180 samples from the six sites. Among these primers, CL966.Contig12 and CL.5285.Contig5 produced the largest number of alleles, i.e. five alleles. The fewest numbers of alleles were exhibited in CL1837.Contig15 and Unigene12747 with two (Table 7). On average, there were four alleles per primer. Shannon’s information index of the primers ranged from 0.31 to 0.92, with a mean of 0.62.

Table 7
Diversity statistics of the eight SSR markers across S. breviflora populations.
LocusNaaNebHocHedIeNmf
CL14453.Contig142.230.050.550.926.76
Unigene1274722.000.020.500.694.28
CL616.Contig3441.630.020.390.674.16
CL1837.Contig1521.330.000.250.4111.57
CL15080.Contig231.190.050.160.3414.99
CL966.Contig1251.640.000.390.7311.52
CL.5285.Contig551.900.130.470.886.26
CL966.Contig1541.170.000.140.317.11
mean41.640.030.360.628.33

a Observed number of alleles.

b Effective number of alleles.

c Observed heterozygosity.

d Expected heterozygosity.

e Shannon’s information index.

f Gene flow.

The genetic diversity of S. breviflora can be calculated using Shannon’s information index (I) for each population. As Table 8 indicates, the grazed populations showed the highest Shannon’s information index value, with a value of 0.64 (pop4 and pop6). In contrast, the ungrazed populations showed the lowest level of genetic diversity, with a value of 0.44 (pop2). The observed numbers of alleles (Na) ranged from 2.13 (pop2) to 3.00 (pop4), with an average of 2.71. The effective number of alleles (Ne) varied from 1.47 (pop2) to 1.71 (pop4), with an average of 1.62. Compared with the mean observed heterozygosity of 0.04 (Ho), the mean expected heterozygosity (He) value was high, with a value of 0.34. This result indicated that the inbreeding rate of S. breviflora is high, and the proportion of heterozygotes is relatively low. As shown in Table 9, both Shannon’s information index (I) and expected heterozygosity (He) in grazed populations are higher significantly than that in ungrazed populations (p<0.05).

Table 8
Genetic diversity statistics of S. breviflora populations.
CodePopulation sizeNaaNebHocHedIePPB (%)f
1292.501.630.050.320.55100.00
2292.131.470.020.280.4487.50
3272.881.610.050.330.51100.00
4303.001.710.030.380.64100.00
5282.881.610.030.360.62100.00
6282.881.660.030.380.64100.00
mean292.711.620.040.340.5797.92

aNa: Observed number of alleles.

bNe: Effective number of alleles.

cHo: Observed heterozygosity.

dHe: Expected heterozygosity.

eI: Shannon’s information index.

fPPB: Percentage of polymorphic bands.

Table 9
Student’s test of genetic parameters between ungrazed and grazed populations.
NaaNebHocHedIe
df4
P value0.1310.1960.4230.019*0.015*

aNa: Observed number of alleles.

bNe: Effective number of alleles.

cHo: Observed heterozygosity.

dHe: Expected heterozygosity.

eI: Shannon’s information index.

*p<0.05.

Discussion

NGS strategies and their application to transcriptomics can be used to meet the increasing demands of acquiring accurate genome information. To clarify the transcriptome responses of S. breviflora to grazing, we compared the transcriptome changes under grazing and nongrazing conditions and found that 686 unigenes showed differential expression. These DEGs were significantly enriched in the “alpha-linolenic acid and metabolism” and “plant-pathogen interaction” pathways, which may enhance the adaptability of S. breviflora to grazing. Based on DEGs, we screened eight grazing-related SSR markers to explore the genetic diversity of S. breviflora and found that grazing has a positive effect on genetic diversity. Changes in gene expression levels help S. breviflora defend against grazing damage, and the increased genetic diversity provides the potential for its adaptation and evolution; all of these factors contribute to the survival of plants in different aspects.

Grazing stimulates the expression of wound- and defense-related genes

As a main effect of grazing on herbage, wounding threat is inevitable and occurs over the entire life [35]. In addition to developing adaptive traits such as low heights, small leaf sizes, low root biomass [47], few vegetative tillers, and short internode lengths [48], plants also modulate the expression levels of related genes, for instance, genes related to the jasmonic acid (JA) family [49], to defend themselves against grazing damage. For S. breviflora, genes such as phospholipases A1 (PLA1) and 13-lipoxygenase (13-LOX), which are known to be involved in the synthesis of JA, were upregulated. For other plants, leaf wounding response were also related to JA synthesis [50, 51]. Singh et al. [52] elucidated the expression profile of rice PLA-encoding genes under salt, cold, and drought stress using microarray data and found that all the DEGs were upregulated. When tomato (Solanum lycopersicum L.) is exposed to methyl-jasmonate treatment and damaged, SILOX4, which belongs to the 13-LOX subfamily, is highly expressed [53]. PLA1 and 13-LOX are shared by grazing and other wounding response in different species, indicating that plants have some common mechanisms in defense response. Herbivore grazing, however, is a joint process that includes wounding, defoliation, and saliva deposition. Chen et al. [54] used rice to study grazing-induced pathway, and found the expression level of 1,3-beta-glucosidase increased. This gene was reported to be associated with resistance in plant, cell wall construction and modification [55, 56]. In our study, gene related to beta-glucosidase was upregulated under grazing, conferring resistance on S. breviflora.

Grazing provides opportunities for pathogens to infect plants [57]. When plants are infected by pathogens, they develop disease resistance by activating mitogen-activated protein kinase (MAPK) cascades [58]. Specifically, MAPK kinase kinases (MAPKKKs) phosphorylate MAPK kinases (MAPKKs), which then phosphorylate MAPKs [59]. In the present study, MAPKK genes showed upregulated expression under grazing, suggesting that MAPKK genes contribute to the defense against invasion by microorganisms. Gene overexpression in the MAPK cascade defense mechanism occurs widely in plants, such as rice [60], Arabidopsis [61], cotton [62], and wheat [63].

Grazing increases the genetic diversity of S. breviflora

Genetic diversity is a fundamental basis for plants to adapt to the environment, and to provide the potential for evolution. Genetic diversity is shaped by the balance between genetic drift, inbreeding, recombination, gene flow, mutation, and selection [64]. Grazing affects plant genetic diversity in different ways. Accompanied by trampling and livestock migration, grazing impacts genetic diversity of populations mainly through gene flow and genome-wide selection that changes the substitution rate of mutants [65].

Gene flow, one of the important forces leads to improving genetic diversity of natural plant populations, occurs by the spread of pollen, seeds, spores, and other genetic materials. S. breviflora is a facultatively selfing species. We found that pollen flow may promote sexual reproduction of S. breviflora. As Table 9 indicates, He in grazing populations are significantly higher than ungrazed populations. Therefore, pollen-mediated gene flow plays an important role in maintaining genetic diversity of S. breviflora populations while stressed by grazing [66]. In general, grazing affects plant reproduction by defoliation. S. breviflora, however, can complete life circle under heavy grazing by increasing reproductive investment, which brings about maintaining even increasing seed germination rate [6769]. Grazing transfers seeds through livestock migration and fosters seedling establishment, resulting in the enhancement of seed-mediated gene flow, and consequently increasing genetic diversity [66], though seed-mediated gene flow was not mentioned in the present study. Another important force driven genetic diversity changes is gene polymorphism. So, we deliberately mined SSRs derived from DEGs of S. breviflora. As a result, we found a higher genetic diversity in grazing populations. This result suggests that grazing promotes the polymorphism of genes with relevance to grazing. These polymorphisms may endue S. breviflora with more grazing tolerance.

Other factors such as marker systems and grazing intensity might be taken in to account. SSR system is more efficient for genetic analysis than the ISSR system [70]. We observed that gene flow of SSR primers in S. breviflora was higher than that of ISSR primers in S. grandis [25] and S. krylovii [24], which varied from 4.16 to 14.99, with a mean value of 8.33 (Table 7). In addition, grazing intensity has also been taken into account in other studies. Shan et al. [25] indicated that the genetic diversity of S. grandis was the highest under light grazing. Similar results were suggested for Elymus. nutans in the study by Ma et al. [26]. For S. krylovii [24] and S. purpurea [71], the highest value appeared in moderately grazed populations. Contradictory results, including a negative relationship [72] and no correlation [73], were reported in other studies. These contradictory results imply the complexity of grazing-induced genetic diversity that are affected by grazing intensity, differences in species, geographic locations and molecular marker systems.

Conclusions

Overall, grazing activated plant defense-related genes and increased genetic diversity in S. breviflora. The desert steppe in Inner Mongolia has become severely degraded because of long-term overgrazing. The S. breviflora community, however, remains stable, and this species occur with S. bungeana, S. klemenzii, and S. krylovii in different types of steppes under diverse conditions of precipitation, temperature, and soil attributes. The reason for this may be explained in part by our findings, i.e., the enhancement of genetic diversity of S. breviflora under grazing improves the adaptability of the species to stressed environments. For maintaining genetic diversity of S. breviflora, a suitable grazing intensity is needed in order to implement rational use and conservation of desert steppe.

References

JFang, YYang, WMa, AMohammat, HShen. Ecosystem carbon stocks and their changes in China's grasslands. Science China Life Science. 2010;53(7):75765. 10.1007/s11427-010-4029-x

YYang, JFang, WMa, PSmith, AMohammat, SWang, et al Soil carbon stock and its changes in northern China's grasslands from 1980s to 2000s. Global Change Biol. 2010;16(11):303647. 10.1111/j.1365-2486.2009.02123.x

HBruelheide, JDengler, BJimenez-Alfaro, OPurschke, SMHennekens, MChytry, et al sPlot—A new tool for global vegetation analyses. Journal of Vegetation Science. 2019;30(2):16186. 10.1111/jvs.12710 000466421500001

TAkiyama, KKawamura. Grassland degradation in China: Methods of monitoring, management and restoration. Grassland Science. 2007;53(1):117. 10.1111/j.1744-697X.2007.00073.x

ZGuo, TLiang, ZZhang. Classification management for grassland in Gansu Province, China. N Z J Agric Res. 2010;46(2):12331. 10.1080/00288233.2003.9513538

YBai, JWu, CMClark, QPan, LZhang, SChen, et al Grazing alters ecosystem functioning and C:N:P stoichiometry of grasslands along a regional precipitation gradient. J Appl Ecol. 2012;49(6):120415. 10.1111/j.1365-2664.2012.02205.x

BZhang, BWThomas, RBeck, KLiu, MZhao, XHao. Labile soil organic matter in response to long–term cattle grazing on sloped rough fescue grassland in the foothills of the Rocky Mountains, Alberta. Geoderma. 2018;318:915. 10.1016/j.geoderma.2017.12.019

TZhang, HZhao, SLi, RZhou. Grassland changes under grazing stress in Horqin sandy grassland in Inner Mongolia, China. N Z J Agric Res. 2010;47(3):30712. 10.1080/00288233.2004.9513599

MEvju, GAustrheim, RHalvorsen, MMysterudAtle. Grazing responses in herbs in relation to herbivore selectivity and plant traits in an alpine ecosystem. Oecologia. 2009;161(1):7785. 10.1007/s00442-009-1358-1

10 

HFreitag. The genus Stipa (Gramineae) in southwest and south Asia. Notes from the Royal Botanical Garden, Edinburgh. 1985;42:355489.

11 

RPWU ZY, DHong. Flora of China. Beijing: Science Press and St. Louis: Missouri Botanical Garden Press; 2006.

12 

MNobis, ANobis, EKlichowska, ANowak, SNowak, PDGudkova. Stipa dickorei sp. nov. (Poaceae), three new records and a checklist of feather grasses of China. Phytotaxa. 2016;267(1):29 10.11646/phytotaxa.267.1.3

13 

MNobis, PDGudkova, ANowak, JSawicki, ANobis. A Synopsis of the Genus Stipa (Poaceae) in Middle Asia, Including a Key to Species Identification, an Annotated Checklist, and Phytogeographic Analyses. Annals of the Missouri Botanical Garden. 2020;105(1):163. 10.3417/2019378

14 

QZhang, JMNiu, SBWu, ABuyantuyev, JJDong. Impact of climatic factors on genetic diversity of Stipa breviflora populations in Inner Mongolia. Gen Mol Res. 2012;11(3):208193. 10.4238/2012.August.6.12

15 

LSheng-lien, WZhen-lan. On Geographical Distribution of the Genus Stipa L. in China. Journal of Systematics and Evolution. 1996;34(3):24253.

16 

MNobis, PDGudkova, EBaiakhmetov, JŻabicka, KKrawczyk, JSawicki. Hybridisation, introgression events and cryptic speciation in Stipa (Poaceae): A case study of the Stipa heptapotamica hybrid-complex. Perspect Plant Ecol Evol Syst. 2019;39:125457 10.1016/j.ppees.2019.05.001

17 

EBaiakhmetov, ANowak, PDGudkova, MNobis. Morphological and genome-wide evidence for natural hybridisation within the genus Stipa (Poaceae). Scientific Report. 2020;10(1):13803 10.1038/s41598-020-70582-1

18 

XLv, QHe, GZhou. Contrasting responses of steppe Stipa ssp. to warming and precipitation variability. Ecology and Evolution. 2019;9(16):906175. 10.1002/ece3.5452

19 

KKrawczyk, MNobis, KMyszczynski, EKlichowska, JSawicki. Plastid super-barcodes as a tool for species discrimination in feather grasses (Poaceae: Stipa). Sci Rep. 2018;8(1):1924 10.1038/s41598-018-20399-w

20 

XLv, GZhou. Climatic Suitability of the Geographic Distribution of Stipa breviflora in Chinese Temperate Grassland under Climate Change. Sustainability. 2018;10(10):3767 10.3390/su10103767

21 

SUPauls, CNowak, MBalint, MPfenninger. The impact of global climate change on genetic diversity within populations and species. Mol Ecol. 2013;22(4):92546. 10.1111/mec.12152

22 

EKlichowska, MSzczecińska, MŚlipiko, MNobis. Different but valuable: Anthropogenic habitats as genetic diversity reservoirs for endangered dry grassland species–A case study of Stipa pennata. Ecol Indicators. 2020;111:105998 10.1016/j.ecolind.2019.105998

23 

EKlichowska, MNobis, PPiszczek, JBłaszkowski, SZubek. Soil properties rather than topography, climatic conditions, and vegetation type shape AMF–feathergrass relationship in semi-natural European grasslands. Applied Soil Ecology. 2019;144:2230. 10.1016/j.apsoil.2019.07.001

24 

JPeng, CLiang, YNiu, WJiang, WWang, LWang. Moderate grazing promotes genetic diversity of Stipa species in the Inner Mongolian steppe. Landscape Ecol. 2015;30(9):178394. 10.1007/s10980-015-0227-z

25 

DShan, MZhao, BHan, GHan. Examining the genetic diversity of Stipa grandis under various grazing pressures. Acta Ecologica Sinica. 2006;26(10):317582. 10.1016/s1872-2032(06)60048-6

26 

DMa, YGuo, FHou, XZhai, WWang, MTian, et al Plant genetic diversity and grazing management on the Qinghai–Tibetan Plateau: A case study of a dominant native wheatgrass (Elymus nutans). Biochem Syst Ecol. 2014;56:1623. 10.1016/j.bse.2014.04.014

27 

JWang, CYang, JYin, TJWang, PTLiu. Changes of the genetic diversity of Aremisia frigida population under the disturbance of grazing. Acta Ecologica Sinica. 2004;24(11):246571.

28 

SESmith, TArredondo, MAguiar, EHuber-Sannwald, AAlpuche, AAguado, et al Fine-Scale Spatial Genetic Structure in Perennial Grasses in Three Environments. Rangeland Ecol Manage. 2009;62(4):35663. 10.2111/08-159.1

29 

DMatlaga, KKaroly. Long–term grazing effects on genetic variation in Idaho fescue. Journal of Range Management. 2004;57(3):2759. 10.2111/1551-5028(2004)057[0275:lgeogv]2.0.co;2

30 

JAMartin, ZWang. Next–generation transcriptome assembly. Nature Reviews Genetics. 2011;12(10):67182. 10.1038/nrg3068

31 

JRen, ZSu, ZDang, YDing, PWang, JNiu. Development and characterization of EST–SSR markers in Stipa breviflora (Poaceae). Applications in Plant Sciences. 2017;5(4):1600157 10.3732/apps.1600157

32 

EKlichowska, MSlipiko, MNobis, MSzczecinska. Development and characterization of microsatellite markers for endangered species Stipa pennata (Poaceae) and their usefulness in intraspecific delimitation. Mol Biol Rep. 2018;45(4):63943. 10.1007/s11033-018-4192-x

33 

SChen, YCai, LZhang, XYan, LCheng, DQi, et al Transcriptome analysis reveals common and distinct mechanisms for sheepgrass (Leymus chinensis) responses to defoliation compared to mechanical wounding. PLoS One. 2014;9(2):e89495 10.1371/journal.pone.0089495

34 

JWang, YZhao, IRay, MSong. Transcriptome responses in alfalfa associated with tolerance to intensive animal grazing. Scientific Reports. 2016;6:19438 10.1038/srep19438

35 

DWan, YWan, XHou, WRen, YDing, RSa. De novo assembly and transcriptomic profiling of the grazing response in Stipa grandis. PLoS One. 2015;10(4):e0122641 10.1371/journal.pone.0122641

36 

MGGrabherr, BJHaas, MYassour, JZLevin, DAThompson, IAmit, et al Full–length transcriptome assembly from RNA–Seq data without a reference genome. Nat Biotechnol. 2011;29:64454. 10.1038/nbt.1883

37 

SFAltschul, WGish, WMiller, EWMyers, DJLipman. Basic local alignment search tool. J Mol Biol. 1990;215(3):40310. 10.1016/S0022-2836(05)80360-2

38 

AConesa, SGotz, JMGarcia–Gomez, JTerol, MTalon, MRobles. Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research. Bioinformatics. 2005;21(18):36746. 10.1093/bioinformatics/bti610

39 

EQuevillon, VSilventoinen, SPillai, NHarte, NMulder, RApweiler, et al InterProScan: protein domains identifier. Nucleic Acids Res. 2005;33(Web Server issue):11620. 10.1093/nar/gki442

40 

CIseli, CVJongeneel, PBucher. ESTScan: a program for detecting, evaluating, and reconstructing potential coding regions in EST sequences. Proceedings International Conference on Intelligent Systems for Molecular Biology. 1999:13848.

41 

BLi, CNDewey. RSEM: accurate transcript quantification from RNA–Seq data with or without a reference genome. BMC Bioinformatics. 2011;12:323–. 10.1186/1471-2105-12-323

42 

STarazona, FGarcia–Alcalde, JDopazo, AFerrer, AConesa. Differential expression in RNA–seq: a matter of depth. Genome Res. 2011;21(12):221323. 10.1101/gr.124321.111

43 

TThiel, WMichalek, RVarshney, AGraner. Exploiting EST databases for the development and characterization of gene–derived SSR–markers in barley (Hordeum vulgare L.). Theor Appl Genet. 2003;106(3):41122. 10.1007/s00122-002-1031-0

44 

AUntergasser, ICutcutache, TKoressaar, JYe, BCFaircloth, MRemm, et al Primer3–new capabilities and interfaces. Nucleic Acids Res. 2012;40(15):e115 10.1093/nar/gks596

45 

STKalinowski, MLTaper, TCMarshall. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Mol Ecol. 2007;16(5):1099106. 10.1111/j.1365-294X.2007.03089.x

46 

RPeakall, PESmouse. GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research–an update. Bioinformatics. 2012;28(19):25379. 10.1093/bioinformatics/bts460

47 

XZuo, JZhang, PLv, SWang, YYang, XYue, et al Effects of plant functional diversity induced by grazing and soil properties on above–and belowground biomass in a semiarid grassland. Ecol Indicators. 2018;93:55561. 10.1016/j.ecolind.2018.05.032

48 

WZhao, SPChen, XGHan, GHLin. Effects of long–term grazing on the morphological and functional traits of Leymus chinensis in the semiarid grassland of Inner Mongolia, China. Ecol Res. 2008;24(1):99108. 10.1007/s11284-008-0486-0

49 

KTsuda, FKatagiri. Comparing signaling mechanisms engaged in pattern–triggered and effector–triggered immunity. Curr Opin Plant Biol. 2010;13(4):45965. 10.1016/j.pbi.2010.04.006

50 

WPSuza, MLRowe, MHamberg, PEStaswick. A tomato enzyme synthesizes (+)-7-iso-jasmonoyl-L-isoleucine in wounded leaves. Planta. 2010;231(3):71728. 10.1007/s00425-009-1080-6

51 

PReymond, HWeber, MDamond, EEFarmer. Differential gene expression in response to mechanical wounding and insect feeding in Arabidopsis. The Plant Cell. 2000;12(5):70719. 10.1105/tpc.12.5.707

52 

ASingh, VBaranwal, AShankar, PKanwar, RRanjan, SYadav, et al Rice phospholipase A superfamily: organization, phylogenetic and expression analysis during abiotic stresses and development. PLoS One. 2012;7(2):e30947 10.1371/journal.pone.0030947

53 

RKUpadhyay, AKMattoo. Genome–wide identification of tomato (Solanum lycopersicum L.) lipoxygenases coupled with expression profiles during plant development and in response to methyl–jasmonate and wounding. J Plant Physiol. 2018;231:31828. 10.1016/j.jplph.2018.10.001

54 

SChen, X-QLi, AZhao, LWang, XLi, QShi, et al Genes and pathways induced in early response to defoliation in rice seedlings. Curr Issues Mol Biol. 2009;11(2):81

55 

HRSingh, PHazarika, NAgarwala, NBhattacharyya, PBhagawati, BGohain, et al Transgenic Tea Over-expressing Solanum tuberosum Endo-1,3-beta-d-glucanase Gene Conferred Resistance Against Blister Blight Disease. Plant Molecular Biology Reporter. 2018;36(1):10722. 10.1007/s11105-017-1063-x

56 

HYang, FSu, JWang, HShi. Comparative shotgun proteomic profiles for identification of differentially expressed proteins in response to topping in Nicotiana tabacum leaves. Acta Physiologiae Plantarum. 2017;39(1):13.

57 

LISørensen, JMikola, MMKytöviita, JOlofsson. Trampling and Spatial Heterogeneity Explain Decomposer Abundances in a Sub–Arctic Grassland Subjected to Simulated Reindeer Grazing. Ecosystems. 2009;12(5):83042. 10.1007/s10021-009-9260-6

58 

GBi, ZZhou, WWang, LLi, SRao, YWu, et al Receptor–Like Cytoplasmic Kinases Directly Link Diverse Pattern Recognition Receptors to the Activation of Mitogen–Activated Protein Kinase Cascades in Arabidopsis. The Plant Cell. 2018;30(7):154361. 10.1105/tpc.17.00981

59 

MHashimoto, KKomatsu, KMaejima, YOkano, TShiraishi, KIshikawa, et al Identification of three MAPKKKs forming a linear signaling pathway leading to programmed cell death in Nicotiana benthamiana. BMC Plant Biol. 2012;12:13 10.1186/1471-2229-12-13

60 

LZXiong, YNYang. Disease resistance and abiotic stress tolerance in rice are inversely modulated by an abscisic acid–inducible mitogen–activated protein kinase. The Plant Cell. 2003;15(3):74559. 10.1105/tpc.008714

61 

DRen, YLiu, KYYang, LHan, GMao, JGlazebrook, et al A fungal–responsive MAPK cascade regulates phytoalexin biosynthesis in Arabidopsis. Proceedings of the National Academy of Sciences of the United States of America. 2008;105(14):563843. 10.1073/pnas.0711301105

62 

JMeng, HGao, WBZhai, JYShi, MZZhang, WWZhang, et al Subtle regulation of cotton resistance to Verticillium wilt mediated by MAPKK family members. Plant Sci. 2018;272:23542. 10.1016/j.plantsci.2018.05.003

63 

XZhu, TQi, QYang, FHe, CTan, WMa, et al Host–induced gene silencing of the MAPKK gene PsFUZ7 confers stable resistance to wheat stripe rust. Plant Physiol. 2017;175(4):185363. 10.1104/pp.17.01223

64 

MDLoveless, JLHamrick. Ecological Determinants of Genetic Structure in Plant Populations. Annual Review of Ecology, Evolution, and Systematics. 1984;15(1):6595.

65 

MMarcotrigiano,. Herbivory could unlock mutations sequestered in stratified shoot apices of genetic mosaics. Am J Bot. 2000;87(3):35561.

66 

YRico, RHolderegger, HJBoehmer, HHWagner. Directed dispersal by rotational shepherding supports landscape genetic connectivity in a calcareous grassland plant. Mol Ecol. 2014;23(4):83242. 10.1111/mec.12639

67 

WLiu. Individual reproductive strategy of Stipa breviflora under different grazing pressures. Grassland Science. 2019;66(3):17482. 10.1111/grs.12263

68 

WLiu, SSun, ZWei. Linking phytogenic hillocks with plant ecological strategies in a desert steppe: Adaptation of Stipa breviflora to heavy grazing. Ecol Indicators. 2020;117:106564 10.1016/j.ecolind.2020.106564

69 

WLiu, ZWei, XYang. Maintenance of dominant populations in heavily grazed grassland: Inference from a Stipa breviflora seed germination experiment. PeerJ. 2019;7:e6654 10.7717/peerj.6654

70 

JSWang, JHHe, HRChen, YYChen, FQiao. Genetic Diversity in Various Accessions of Pineapple [Ananas comosus (L.) Merr.] Using ISSR and SSR Markers. Biochem Genet. 2017;55(5–6):34766. 10.1007/s10528-017-9803-z

71 

X-YZhai, Y-XGuo, F-JHou, YLiu, D-TMa, WWang, et al Population genetic structure and germplasm conservation of Stipa purpurea on Qinghai-Tibetan Plateau under grazing. Biochem Syst Ecol. 2015;62:517. 10.1016/j.bse.2015.07.036

72 

CPSouto, MTadey. Livestock Effects on Genetic Variation of Creosote Bushes in Patagonian Rangelands. Environ Conserv. 2018;46(1):5966. 10.1017/s0376892918000280

73 

RJamnadass, ESMace, PHiernaux, AMuchugi, JHanson. Population genetic responses of wild forage species to grazing along a rainfall gradient in the Sahel: A study combining phenotypic and molecular analyses. Euphytica. 2006;151(3):43145. 10.1007/s10681-006-9175-7